ID: 957961292

View in Genome Browser
Species Human (GRCh38)
Location 3:87256921-87256943
Sequence CAGTGTTTGGGGATGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957961292_957961299 23 Left 957961292 3:87256921-87256943 CCCGCCGCCATCCCCAAACACTG 0: 1
1: 0
2: 1
3: 21
4: 341
Right 957961299 3:87256967-87256989 ATCCTTTCCACCTTTAGAGATGG 0: 1
1: 0
2: 0
3: 31
4: 166
957961292_957961301 28 Left 957961292 3:87256921-87256943 CCCGCCGCCATCCCCAAACACTG 0: 1
1: 0
2: 1
3: 21
4: 341
Right 957961301 3:87256972-87256994 TTCCACCTTTAGAGATGGAAAGG 0: 1
1: 0
2: 0
3: 22
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957961292 Original CRISPR CAGTGTTTGGGGATGGCGGC GGG (reversed) Intergenic
900151315 1:1180420-1180442 AAGGGGTTGGGGATGGCGGGCGG - Intronic
900228656 1:1544796-1544818 CAGGGTCTGGGGATGCCTGCAGG - Intronic
900500846 1:3003788-3003810 CAGTGTATGGGGCTGCCGTCGGG + Intergenic
901032959 1:6319026-6319048 CAGTGAATGGGGTTGGGGGCTGG - Intronic
901407150 1:9056939-9056961 CAGTGTTTGGGGACCTAGGCAGG - Intronic
901529641 1:9844817-9844839 CAGGTTTTGGGGAAGGCGGAGGG + Intergenic
902052083 1:13571693-13571715 TAGTGTTGGGTGATGGAGGCTGG - Intergenic
902376132 1:16030713-16030735 CAGTGTTTGGGCTTGGCTGGGGG + Intronic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903213668 1:21831748-21831770 CAGTGGTGTGGGATGGCGGATGG + Exonic
903630879 1:24769455-24769477 CATTGTTTGGGTATGGTTGCAGG + Intronic
904440794 1:30528378-30528400 CAGTGATTGGGAATGGGGACAGG - Intergenic
905336381 1:37247552-37247574 GAGTGCTGGGGGATGGCGGGAGG + Intergenic
906510133 1:46405974-46405996 GTGGGTGTGGGGATGGCGGCGGG + Intronic
909475236 1:76074664-76074686 CAGTGGATGGGGACGGGGGCGGG + Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911187224 1:94916076-94916098 CAGTGTATGAGGCTGGCAGCAGG - Intronic
912383808 1:109261485-109261507 CAGGAGTTGGGGATGGGGGCAGG - Intronic
912442894 1:109712482-109712504 GTGTGTTTGGGGGTGGGGGCGGG + Intronic
914400902 1:147319046-147319068 CACTGTCTGGGGTTGGTGGCTGG - Intergenic
915310748 1:155004808-155004830 CAGTGTCTGGGGGTGCCAGCAGG - Intronic
915340676 1:155175061-155175083 CAGAGATGGGGGATGGAGGCAGG + Intronic
915539978 1:156559527-156559549 CATTGTGTGGGGGTGGCGGGAGG - Intronic
915820183 1:159014973-159014995 GAGGGTTTGGGGATGGTTGCAGG - Intronic
918082960 1:181221576-181221598 CAGTGTCTGGGGGAGGCGGAGGG + Intergenic
920106393 1:203556331-203556353 CAGGGTTGGGGGATGGGGGGTGG + Intergenic
920577573 1:207072742-207072764 AAGTGTTGGGGGATGGAGGGCGG + Exonic
920616309 1:207496142-207496164 CAGAGTGTGGGGAGGGCTGCGGG - Intronic
921472062 1:215561551-215561573 CGGAGTAGGGGGATGGCGGCAGG - Intergenic
921514307 1:216070847-216070869 CAGTTTTTGGGGGTGGGGGTGGG + Intronic
922187091 1:223285300-223285322 CAGTGACTGGGGATGGGGCCAGG + Intronic
922751165 1:228070642-228070664 CAGTGTAGGGGGATAGCGTCGGG + Intergenic
923606984 1:235453065-235453087 AAGTCTTTGGGGATGGCCTCAGG - Intronic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1063608026 10:7540036-7540058 AAGTTTTTGGGGATGGAGGGAGG - Intergenic
1064232453 10:13541202-13541224 CAGTGTTTGCGGATGGGGAGAGG + Intergenic
1064687984 10:17884250-17884272 CAGGGGCTGGGGATGGTGGCTGG - Intronic
1064756546 10:18576626-18576648 TAGTGTTGGGGGATGGAAGCTGG - Intronic
1068671738 10:59730120-59730142 TAGTGTTGGGAGATGGAGGCTGG + Intronic
1069588984 10:69630389-69630411 CAGAGGCTGGGGCTGGCGGCCGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070328649 10:75403319-75403341 CAGCCTGCGGGGATGGCGGCAGG - Intergenic
1070769109 10:79071957-79071979 CAGTGACTGGGGGTGGGGGCTGG + Intronic
1071400361 10:85262680-85262702 CATTGGTTGGGCATGGTGGCGGG + Intergenic
1072614658 10:97041429-97041451 CAGAGTTGGGGCATGGGGGCCGG + Intronic
1072705206 10:97675921-97675943 CAGTGTCAGGGAATGGAGGCTGG + Exonic
1072982610 10:100112006-100112028 CAGTGATAGGGTATGGAGGCTGG - Intergenic
1074859768 10:117501554-117501576 CAGGGGTTGAGGATGGGGGCAGG + Intergenic
1075223603 10:120605126-120605148 GGGTGTTTGGGGATGGAGGGTGG + Intergenic
1075564659 10:123494671-123494693 AAGGGTTTGGGGATGGCTACAGG - Intergenic
1075711670 10:124534018-124534040 CAGAGTTTGGGGATTGGGGCGGG + Intronic
1075812303 10:125233315-125233337 CAGTGTTTAGGGACTCCGGCCGG + Intergenic
1076594102 10:131614499-131614521 CATTGTTTGGGTTTGGTGGCTGG + Intergenic
1077339918 11:2021683-2021705 CCGGGTGTGGGGGTGGCGGCAGG - Intergenic
1077632449 11:3819976-3819998 CAGAGTTTGGGGAAGGCCTCAGG - Intronic
1077971136 11:7192426-7192448 CAGGGTGTGGGGATGGGGGCAGG - Intergenic
1078407292 11:11081481-11081503 CAGTGTGTGGGGCTGGCTGCTGG + Intergenic
1078470187 11:11580319-11580341 TAGTCTTTGGGGGTGGCGGGAGG - Intronic
1081235978 11:40647675-40647697 AAGTGTTTGGGAATGGTAGCTGG - Intronic
1081360872 11:42176306-42176328 AAGTGTGTGGGAATGGAGGCAGG - Intergenic
1082009521 11:47441017-47441039 CAGAGTATGGGGTTGGCTGCAGG + Intronic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1082852321 11:57776309-57776331 GAGTGTTTGGGGGTGGGGGTTGG + Intronic
1083089949 11:60189525-60189547 TAGTGTTGGGAGATGGCAGCTGG - Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1084603679 11:70160792-70160814 CTGTGCTTGGGGATGGTGCCTGG + Intronic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1087433060 11:98078107-98078129 CATTGTTTGGGGATGGAGGGCGG - Intergenic
1087886117 11:103484700-103484722 AAGTGTTTTGGGAGGGAGGCAGG - Intergenic
1088221025 11:107570196-107570218 CAGAGTTTGGCCACGGCGGCTGG - Intergenic
1089291100 11:117438347-117438369 TAGTGTTAGGGGTTAGCGGCAGG + Intronic
1089307585 11:117536294-117536316 CGCTGTTTGGGGATGGAGACGGG + Intronic
1089432771 11:118436904-118436926 CCGTGTTTGGGGAGAGCGGCGGG + Exonic
1090089747 11:123684683-123684705 TAGGGATTGGGGATGGCGGGTGG - Intergenic
1202822903 11_KI270721v1_random:76872-76894 CCGGGTGTGGGGGTGGCGGCAGG - Intergenic
1092570439 12:9715712-9715734 CAGTGGGTGGGGATGGCAACTGG - Intergenic
1093235570 12:16605446-16605468 CTGTGTTTGGGCATGGGGGCGGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1097012502 12:55963251-55963273 CAGAGATTGGGGATGGGGACAGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1098346973 12:69515883-69515905 CAGTGTGTGGGGGTGGGGGTGGG - Intronic
1099513651 12:83569134-83569156 CAGGGTTTGGGGTTGGGGGGTGG + Intergenic
1101062210 12:100984065-100984087 CACTGGTTGGGCATGGGGGCTGG - Intronic
1101547139 12:105725663-105725685 AAGTGGTTGGGGATGGCAACAGG - Intergenic
1102753149 12:115313808-115313830 CAGTGAGTGGGGATGGGAGCTGG - Intergenic
1103130107 12:118460697-118460719 CAGTGTTTGGTGAGGGCTGCTGG - Intergenic
1103289437 12:119832635-119832657 CAGTGTATGGGGGTGGGGACAGG - Intronic
1103402254 12:120650859-120650881 CAGGCTTTGGGCATGGCGGTCGG + Intronic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1108180659 13:47836847-47836869 CAGTGCTGGGGAATGGCAGCAGG + Intergenic
1108869129 13:54960481-54960503 CAATTTTTGGGGATAGGGGCTGG + Intergenic
1111333743 13:86793479-86793501 AAGTGTTTGGGTATGGGGTCAGG - Intergenic
1113226128 13:108161580-108161602 CAGTGTTCGGGGATTGAGCCTGG - Intergenic
1113343366 13:109448026-109448048 CAGTGTTTGGTGATGGGTGGGGG - Intergenic
1113360983 13:109631274-109631296 CAGTGTTTTGTTATGGCAGCCGG + Intergenic
1113747266 13:112754062-112754084 CAGTGTTTTGGGATTGAGGAGGG + Intronic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1115211480 14:30971033-30971055 TAGTGTTGGGAGATGGAGGCTGG - Intronic
1115343612 14:32318613-32318635 CAGTGGTTGTGGATGGCCGACGG + Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117336782 14:54762747-54762769 CAGGGTTTGGGGTTGGGGGAGGG - Intronic
1117602870 14:57392035-57392057 AAGTGTTTGAGGATGCGGGCGGG - Intronic
1118330595 14:64812650-64812672 CAGTGGGTGGGGCTGGCAGCTGG - Intronic
1119192061 14:72689593-72689615 CACTGTTTGGGGATAGGGGGTGG - Intronic
1119783414 14:77294664-77294686 CATTTTATGTGGATGGCGGCAGG - Intronic
1121328829 14:93036961-93036983 CATTGTTAGGGGGTGGGGGCCGG - Intronic
1122883530 14:104700529-104700551 CTGTGGTTGGGGACAGCGGCTGG + Intronic
1122968663 14:105143687-105143709 CAGTGTTGGGGGCAGGCTGCTGG - Intronic
1122981138 14:105192868-105192890 CCGTGGTTGGGGAATGCGGCTGG - Intergenic
1123018860 14:105388258-105388280 CAGTGTGAGGAGACGGCGGCTGG - Intronic
1124068773 15:26371586-26371608 AAGGGTTTGGGGAGGGCGGAGGG - Intergenic
1124641238 15:31397855-31397877 TGGTCTTTGGGGGTGGCGGCGGG + Intronic
1125085199 15:35721737-35721759 CACTGTTGGGGGATGGCGGCAGG + Intergenic
1125091094 15:35793757-35793779 CAGGGTTGGGGGATTGGGGCAGG - Intergenic
1126864674 15:52923671-52923693 CAGTTTTTGGGGGTGGGGGTGGG + Intergenic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128335356 15:66782205-66782227 CAGTGGATAGGGATGGCGGTGGG + Exonic
1128609869 15:69064967-69064989 CAGTGTTTGGAGAAGGATGCAGG - Intergenic
1131423377 15:92326086-92326108 CAGTGATGGGGGATGGTGGGTGG + Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1132937309 16:2487717-2487739 TGGTGTTTGGGGATGGCAGGTGG + Intronic
1133961003 16:10493333-10493355 TAGTGTTGGGAGATGGAGGCTGG - Intergenic
1135688708 16:24519217-24519239 CAGTGTCTGGAGATCGAGGCAGG - Intergenic
1136076495 16:27820814-27820836 CGGTGTCTGGGGTTGGAGGCTGG - Intronic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1138561104 16:57801649-57801671 CAGTGTTGGGGTATGGAGGTGGG + Intronic
1138621584 16:58215675-58215697 CAGTGGGTGGGGATGACAGCAGG - Intergenic
1139594859 16:67951584-67951606 CAGTGTCAGGGGCTGGTGGCTGG + Intronic
1139722724 16:68869925-68869947 CAGTGAGTGGGGATGGTGGCTGG + Intronic
1140760088 16:78102157-78102179 CAGTGCTTCGGGAGGGAGGCTGG - Intronic
1141517702 16:84557400-84557422 CAGTCTTTGGGGATGGTCCCAGG - Intergenic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143870479 17:9954459-9954481 CAGTGATGGGGGATGGGGGGTGG + Intronic
1144777287 17:17791303-17791325 TAGTGTCTGGGGATGGATGCAGG - Intronic
1145937956 17:28726196-28726218 AACTGTGTGGGGCTGGCGGCCGG - Exonic
1146608761 17:34286130-34286152 CAGTGTTTGGGAATGGGGAATGG + Intronic
1146685836 17:34841075-34841097 CAGGGCTTGGGGATGGGGGTGGG + Intergenic
1147592830 17:41695914-41695936 CAGCGTGTGGGGATGGGGGCAGG - Intergenic
1147924166 17:43936347-43936369 AAGAGCTTGGGGATGGGGGCTGG + Intergenic
1148828904 17:50416360-50416382 TAGTGTTGGGAGATGGAGGCTGG + Intergenic
1148868130 17:50639690-50639712 CAGTGGTTGGGGCTGGCAGGGGG + Intronic
1149430456 17:56593157-56593179 CGGTGTTTGGGGAGGGGGGGCGG - Intergenic
1149456078 17:56789648-56789670 GAGTGTTTGTGGATGGGGGGAGG + Intergenic
1149788220 17:59454453-59454475 CAGTGTTAGGTGATGTTGGCTGG - Intergenic
1151354658 17:73551202-73551224 CACTGTTGGGTGATGGCGGCCGG + Intronic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152664505 17:81559471-81559493 CAGAGTGTGGGCATGGGGGCAGG + Intronic
1152862341 17:82703571-82703593 GAGGGTTCGGGGATGGCTGCTGG + Intergenic
1153336205 18:3928084-3928106 CAGTGTGTGTGGATGGCGAGCGG - Intronic
1153390443 18:4551905-4551927 AAGTGTTTTGGGATGGGGGCTGG + Intergenic
1153993898 18:10423191-10423213 CAGAGTCTGTGGAGGGCGGCTGG - Intergenic
1154160844 18:11980496-11980518 CAGTGTTTGGGGTTAGCGGAGGG + Intergenic
1158488190 18:57887006-57887028 CAGTGTCTGGGCATGGTGCCTGG - Intergenic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1161195332 19:2983322-2983344 GAGTGTTAGGGGATGAGGGCTGG + Intronic
1161209248 19:3057632-3057654 CAGTGTTGGGGGCGGGCGACAGG - Intronic
1161352849 19:3803481-3803503 CAGTGTTTGGGACGGGGGGCAGG - Intergenic
1162582848 19:11540912-11540934 CATAGTTGGGGGATGGGGGCTGG - Intronic
1162777767 19:12990184-12990206 GAGTGATGGGGGATGGAGGCAGG - Intergenic
1163640125 19:18457334-18457356 CAGGGTATGAGGATGGGGGCGGG + Intronic
1163736914 19:18987413-18987435 GTGTGTTGGGGGTTGGCGGCAGG + Intergenic
1163867028 19:19782137-19782159 TAGTGTTGGGAGATGGAGGCTGG + Intergenic
1164290945 19:23868160-23868182 CAGTTTTTAGGAATGGCTGCTGG - Intergenic
1167387425 19:49171957-49171979 CAGGAGTTGGGGATGGAGGCGGG + Intronic
1167627718 19:50603788-50603810 CAGGGGATGGGGATGGCGACAGG - Intergenic
1167628077 19:50605682-50605704 CAGGGGATGGGGATGGCGACAGG - Intergenic
1167816627 19:51887944-51887966 CAAGTTTCGGGGATGGCGGCCGG + Exonic
1202649740 1_KI270706v1_random:169582-169604 CAGTGAGTGAGGTTGGCGGCTGG + Intergenic
925156103 2:1649864-1649886 CTGTGTTTGGGGCTGGAGGAGGG - Intronic
926775415 2:16417523-16417545 CAATGTCTGTGGATGGCTGCAGG + Intergenic
928925848 2:36578518-36578540 CAGCCTTTGGGGCTGGTGGCAGG - Intronic
929467039 2:42154384-42154406 AAGTGATTGGGGAAGGAGGCTGG + Intergenic
932129790 2:69177601-69177623 CAGGGATTGGGGAGGGAGGCCGG - Intronic
932284488 2:70520778-70520800 TAGTGTTTGGGCATGGAAGCAGG - Intronic
932333627 2:70916533-70916555 CAGGATTTGGGGATGGAGGAAGG - Intronic
933078044 2:77954293-77954315 CAGGGGATGGGGATGGCGACAGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
935970641 2:108527803-108527825 TAGTGTTGGGAGATGGAGGCTGG - Intergenic
936419538 2:112350082-112350104 CAGTGTTGGGAGACGGAGGCTGG + Intergenic
937260446 2:120582739-120582761 GTGTGTTTGTGGATGGTGGCTGG - Intergenic
938562789 2:132489410-132489432 CTGTGACTGGGGCTGGCGGCAGG + Intronic
939949688 2:148455282-148455304 CAGGGTTTGGGGATGGAGTATGG - Intronic
941270094 2:163414652-163414674 CAGTGTTTGGGGCTTGGGGAAGG + Intergenic
942715628 2:178888444-178888466 CAGTATGTGGGCATGGCGGGAGG - Intronic
945052696 2:205839881-205839903 CATCTTTTGTGGATGGCGGCAGG + Intergenic
947452968 2:230225353-230225375 CAGTGTTTGGACATGGGGCCAGG - Intronic
948190193 2:236052308-236052330 GTGTGTTTGGGGGTGGGGGCAGG - Intronic
948706872 2:239800110-239800132 CAGTGAGTGGGGTTGGGGGCTGG - Exonic
948941992 2:241201370-241201392 CAGGGTTTGGGGCCCGCGGCAGG - Intronic
1169466375 20:5844452-5844474 ATGTGTTTGGGGATGGCTGGAGG + Intronic
1171295179 20:24011192-24011214 CAATGCTTGGGGAAGACGGCTGG + Intergenic
1172941825 20:38659444-38659466 AAGTGGTTGGGGATGGGGGTGGG - Intergenic
1173274121 20:41564499-41564521 CAGTGGTTGGGGTTGGGGACAGG + Intronic
1173504121 20:43573771-43573793 CTGTGTTTGGGTATGGTGGGTGG + Intronic
1175378841 20:58548807-58548829 CAGTGTTTGGGGGAGGGGGTTGG - Intergenic
1175940121 20:62533909-62533931 CAGTGTCTGTGGGTGGGGGCAGG + Intergenic
1176602082 21:8802965-8802987 CAGTGAGTGAGGTTGGCGGCTGG - Intergenic
1176602141 21:8803300-8803322 CAGTGTGTGAGGTTGGTGGCTGG + Intergenic
1176625906 21:9091762-9091784 CAGTGAGTGAGGTTGGCGGCTGG + Intergenic
1177769626 21:25500036-25500058 CAGAATTTGGGGATGGGGTCTGG + Intergenic
1179608088 21:42531215-42531237 GAGTGTGCGGGGAAGGCGGCGGG - Intronic
1179675127 21:42975370-42975392 CAGTGTTTGGGGCCGGGTGCTGG + Intronic
1179775643 21:43660059-43660081 CAGTGATTCGAGATGCCGGCTGG - Intronic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1181051181 22:20239012-20239034 CAGGGGTTGGGGGTGGCAGCTGG - Intergenic
1182418366 22:30236018-30236040 GAGTGTCTGGGGCTGGGGGCGGG - Intergenic
1182489685 22:30663108-30663130 CTGTTTTTGGGGAGGGCTGCAGG + Exonic
1183123473 22:35751398-35751420 GAGGGTTGGGGGATGGCGGCAGG + Intronic
1183303653 22:37070647-37070669 CACAGTCTGGGGATGGGGGCAGG + Exonic
1183458166 22:37933918-37933940 CAGACTGTGGGGATGGTGGCAGG + Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1183601911 22:38844587-38844609 CAGTGTTGGGGGTTGGGGGGAGG + Intergenic
1185160991 22:49229773-49229795 CAGTGGTCGGGGATGGCAGTGGG - Intergenic
951248490 3:20367627-20367649 TAGTGTTGGGAGATGGAGGCTGG + Intergenic
953830894 3:46296938-46296960 CTGTATGTGGGGATGGCGGGTGG - Intergenic
953872481 3:46639270-46639292 ATGTGTTTGGGGATGGGGGTGGG + Intergenic
954381265 3:50220541-50220563 CAGGGTCGGGGGATGGCTGCAGG - Exonic
956161198 3:66354859-66354881 CATTTTATGTGGATGGCGGCAGG - Intronic
957194052 3:77045042-77045064 CAATGTTGGGGGAGGGAGGCGGG + Intronic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
960874048 3:122279032-122279054 CAGTGTTGTGGGATGGCTTCTGG + Intronic
960934392 3:122888615-122888637 CAGTGTATTAGGATGGAGGCGGG - Intergenic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
963076580 3:141353011-141353033 CAAGGTTTGGGGATGGGGGAAGG - Intronic
963301773 3:143605426-143605448 CAGTGTGTGGGAATAGCTGCTGG - Intronic
963909154 3:150800405-150800427 AAGAGTATGGGGGTGGCGGCTGG - Intergenic
963990275 3:151645051-151645073 CAGTCTCTGGGGATGGAGGGAGG - Intergenic
964771018 3:160224970-160224992 CAGAGTTTGGGGGTGGGGGGTGG - Intergenic
965264032 3:166518123-166518145 CAGTGTTGGGGGCTGGGGGAGGG - Intergenic
966914739 3:184578478-184578500 GAGAGCTTGGGGAGGGCGGCGGG - Intronic
967079219 3:186033566-186033588 CAGAGTTTGGGGGTGGCTGGAGG - Intergenic
967557673 3:190877306-190877328 CAGGGGATGGGGATGGCGACAGG + Intronic
968040468 3:195584700-195584722 CACTGCTTGGGGGTGGGGGCCGG + Intergenic
968971524 4:3798137-3798159 CAGTGACTGGGGACAGCGGCAGG + Intergenic
969542692 4:7803535-7803557 CTGTGGTTGGGGATCGGGGCCGG - Intronic
969752952 4:9126047-9126069 CAATCTTTGGGGATGATGGCTGG - Intergenic
970210326 4:13703280-13703302 CAGTGTGTGGGGAAGGCTGGTGG - Intergenic
970437154 4:16046918-16046940 CAGTGTTTGGGAATGAGGGTGGG - Intronic
971060056 4:22957836-22957858 CACTGTCTGGGGATGGCAGTAGG + Intergenic
972274998 4:37549079-37549101 TAGTGTTGGGGCATGGAGGCTGG - Intronic
972391433 4:38617330-38617352 CAGTGTTTGGAGGTGGGGCCTGG + Intergenic
973365404 4:49204772-49204794 CAGTGAGTGAGGTTGGCGGCTGG - Intergenic
978583700 4:110256578-110256600 CTGTGTCTGGGGAGGGCTGCAGG + Intergenic
980170508 4:129283916-129283938 TAGTGTTTTGGGATGGAGGCTGG + Intergenic
981905233 4:149915218-149915240 GGGTGTTTGGGGATGAGGGCAGG - Intergenic
981991837 4:150930827-150930849 CAGTGTTAGGAGATGACAGCTGG + Intronic
1202762780 4_GL000008v2_random:126397-126419 CAGTGAGTGAGGTTGGCGGCTGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986315794 5:6585534-6585556 CAGTGTTTGGGCACGGTGTCTGG - Intergenic
988724296 5:33910459-33910481 CAGTGTTTGGGTATTGCAGCTGG + Intergenic
992436711 5:76761681-76761703 CATTGTATGTGGATGGCGGCAGG - Intergenic
994028457 5:95113414-95113436 CACTGCTTGGGGATGGGGGAGGG - Intronic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
996430529 5:123371336-123371358 CATTTTATGTGGATGGCGGCAGG + Intronic
996646237 5:125821585-125821607 CAGTGTTTGGATATTGCTGCTGG - Intergenic
996890292 5:128411156-128411178 GAGTGTTTCCGGATGCCGGCAGG + Intronic
998037924 5:138932392-138932414 CTCTGCTTGGGGATGGAGGCGGG - Intronic
998098437 5:139411877-139411899 CAGTGGTTGGGGATGGGGAGAGG + Exonic
998374801 5:141683078-141683100 CAGTGTTTGGGTGTGGGGGGGGG + Intergenic
998664951 5:144286581-144286603 CATTGTTTAGGCATGGGGGCTGG + Intronic
999578273 5:153005310-153005332 CTGTGTTTGTTGATGGCAGCTGG - Intergenic
999832025 5:155329336-155329358 GAGTGTTTAGAGATGGCTGCAGG - Intergenic
1000014823 5:157267011-157267033 CTCTGCTTGGGGATGGGGGCAGG + Intronic
1000584538 5:163080595-163080617 CAGTATTTTGGCATGGAGGCAGG - Intergenic
1003000364 6:2325973-2325995 CAGTGTTGGAGGATGGGGCCTGG + Intergenic
1005480419 6:26250057-26250079 GAGGGTTAGGGGATGGGGGCAGG - Intergenic
1005905718 6:30260299-30260321 CGGTGTTCGGGGCTGACGGCGGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1008508455 6:52253904-52253926 CAGAGTTTTGGGATGGTGGGTGG + Intergenic
1010188463 6:73169111-73169133 AAATGTTTGGGGAAGGCAGCAGG - Intronic
1012007777 6:93736043-93736065 CAGTGTTTGGGGAAGTCTCCAGG - Intergenic
1013479640 6:110542981-110543003 CAGGGTATGGGGTTGGGGGCTGG + Intergenic
1014488466 6:122031537-122031559 CAGAGGTTATGGATGGCGGCAGG - Intergenic
1015054142 6:128878913-128878935 CAGTGTTTGGAGGTGGGGACAGG + Intergenic
1015876513 6:137828236-137828258 CAGTCTCTGGGGATGGTGCCTGG - Intergenic
1016256777 6:142116070-142116092 CATCTTATGGGGATGGCGGCAGG - Intergenic
1017238774 6:152144775-152144797 CAGTGATGTGGGATGTCGGCGGG - Intronic
1017729861 6:157305734-157305756 CAGTGTTTCAGGATGGAGGGGGG + Intronic
1018646213 6:165951117-165951139 CACTGTTTAGGGATGTCAGCTGG + Intronic
1018923867 6:168193627-168193649 CAGGGTTTGGGAACGGGGGCAGG + Intergenic
1019343860 7:520356-520378 CAGTCTTTGGGGAAGGAGGGGGG + Intergenic
1019498641 7:1353126-1353148 CAGTGGGTGGGGAAGGCGGTGGG - Intergenic
1019868636 7:3737293-3737315 CCCTGTTTGGGGGTGGCTGCAGG + Intronic
1020186151 7:5960897-5960919 AAGTGTTGGGGGGTGGGGGCGGG + Intronic
1020706127 7:11546127-11546149 CAATGGTTGGGGAAGGCTGCAGG - Intronic
1021688030 7:23206236-23206258 CAGTGTCTCCGGGTGGCGGCGGG + Intergenic
1026000519 7:66556916-66556938 CAGGGTTTGGAGATGATGGCGGG + Intergenic
1028841686 7:95435328-95435350 CAGCTTTTGGGGATGGGGGTCGG + Intergenic
1029704796 7:102270574-102270596 CAGAATTGGGGGATGGCTGCTGG - Intronic
1030838595 7:114319522-114319544 CATTGTATGAGGATGGCAGCAGG + Intronic
1031311692 7:120207128-120207150 CAGTGGTCGGGGAGGGTGGCAGG - Intergenic
1032079161 7:128850051-128850073 CAGTGTGTGGGGCGGGCGCCGGG - Exonic
1032111141 7:129076763-129076785 CACTGTTTGGGGGTGGTAGCTGG - Intergenic
1033343890 7:140512539-140512561 CAGGGGTGGGGGATGGTGGCAGG + Intergenic
1033941442 7:146659900-146659922 CAGTGCTGAAGGATGGCGGCTGG + Intronic
1035155068 7:156905810-156905832 CAGTTTTAGGGGTTGGGGGCAGG + Intergenic
1035367359 7:158357843-158357865 CAGAGTTGAGGGCTGGCGGCTGG - Intronic
1035636047 8:1145180-1145202 CTGTGTTTCTGGATGGTGGCTGG - Intergenic
1036077530 8:5518056-5518078 CAGTGCTTGAGAATGGCAGCAGG - Intergenic
1036708158 8:11060137-11060159 CAGAGCTTGGGGAGGGTGGCAGG + Intronic
1036874742 8:12464281-12464303 CAGTCTTTGGGGATCATGGCTGG + Intergenic
1037490617 8:19393885-19393907 CAGTGTTGGGGGATGGTTTCAGG + Intronic
1040567751 8:48582487-48582509 CAGTGTTTCCAGATGGCCGCTGG - Intergenic
1041227194 8:55712385-55712407 TAGTGTTGGGAGATGGAGGCTGG - Intronic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1041727173 8:61029335-61029357 CAGTTTTCTGGGATGGCTGCAGG - Intergenic
1044715357 8:95094935-95094957 CAGAGTTTGGGGGTGGCGGGGGG + Intronic
1044963498 8:97553949-97553971 CAGTGCTTGGGGTTGGCTGGAGG + Intergenic
1045737857 8:105318257-105318279 CGGTGGTGGGGGATGGGGGCAGG - Intronic
1046018401 8:108634238-108634260 CATTTTTTGGGGATGGAGGTGGG - Intronic
1048192238 8:132300520-132300542 CAGGGTTTTGAGATGGCAGCGGG + Intronic
1048484062 8:134831709-134831731 CAGGGTATGGGGCGGGCGGCGGG - Intergenic
1049657228 8:143804236-143804258 CGGTCCTTGGGGATGGCGGGCGG + Intronic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1053700605 9:40686073-40686095 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054311897 9:63485471-63485493 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054410671 9:64809528-64809550 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1057801329 9:98192851-98192873 CAGTGATTGGGGCGGGCTGCCGG + Intergenic
1057804671 9:98211657-98211679 AAGTGTTTGGAGATGGCGACCGG - Intronic
1058349046 9:103999576-103999598 CAGTGTCTTTGGGTGGCGGCGGG + Intergenic
1059115867 9:111599619-111599641 CACTGCCTGGGGAAGGCGGCTGG + Exonic
1059339484 9:113589518-113589540 CAGAGGCTGAGGATGGCGGCTGG + Intronic
1060776188 9:126376592-126376614 CAGTGTTCAGGGGAGGCGGCTGG + Intronic
1060828733 9:126700837-126700859 ATGTGTCTGGGGATGGCGGGTGG - Exonic
1060885419 9:127148851-127148873 CAGAATGTGGGGATGGCGGAGGG + Intronic
1060886883 9:127160715-127160737 CAGTGCTAGGGGCTGGAGGCTGG - Intronic
1062014880 9:134286435-134286457 CACTGTTTGGGGGTGGGGGATGG - Intergenic
1203749078 Un_GL000218v1:62183-62205 CAGTGAGTGAGGTTGGCGGCTGG + Intergenic
1203543543 Un_KI270743v1:111278-111300 CAGTGAGTGAGGTTGGCGGCTGG - Intergenic
1186680477 X:11868356-11868378 CAGGGGTTGAGGATGGAGGCTGG + Intergenic
1187318492 X:18220188-18220210 CAGCGTTTTGGCATAGCGGCTGG - Intronic
1188270599 X:28135408-28135430 CAGGGTTTAGGGATGGTGGGAGG - Intergenic
1190176238 X:48152579-48152601 CAGGGGTTGGGGATGGTGGATGG + Intergenic
1190201013 X:48360843-48360865 CAGGGATTAGGGATGGCGGATGG - Intergenic
1190217976 X:48492799-48492821 CAGAGTTTGGAGCTGGGGGCGGG + Intergenic
1190667839 X:52711293-52711315 CAGGGATTAGGGATGGCGGATGG - Intergenic
1190669126 X:52723572-52723594 CAGGGGTTAGGGATGGCGGATGG - Intergenic
1190670291 X:52734832-52734854 CAGGGGTTAGGGATGGCGGATGG + Intergenic
1190671578 X:52747111-52747133 CAGGGATTAGGGATGGCGGATGG + Intergenic
1190735045 X:53250571-53250593 CACTGTTGGGGGCTGGTGGCAGG + Exonic
1190771277 X:53516793-53516815 TAGTGTTGGGAGATGGAGGCTGG - Intergenic
1191673510 X:63770812-63770834 CATTGTATGTGGATGGCAGCAGG - Intronic
1192875362 X:75223706-75223728 CACTGCTGGGGGATGGAGGCGGG + Intergenic
1194394764 X:93368804-93368826 CAGTGTTTGGAGGTGGAGACTGG - Intergenic
1194877670 X:99209060-99209082 CACTGTTGGGGGATGGAGGAGGG + Intergenic
1195397242 X:104424919-104424941 CAGGGTTTGGGAAAGGGGGCTGG - Intergenic
1195403186 X:104483944-104483966 CACTTTATGGGGATGGCAGCAGG - Intergenic
1195492116 X:105483093-105483115 CAGTGTGTGGGGATGGGTGGTGG - Intronic
1196287594 X:113900258-113900280 CAGTGAATGGGGATGGGGGTGGG - Intergenic
1196630075 X:117927813-117927835 CAGGGTTTAGGGATGGTGGTGGG + Intronic
1197457936 X:126701311-126701333 CACTGTTTGAGGTTGGAGGCAGG - Intergenic
1198173936 X:134135963-134135985 CAGTGTTGGGGGAGGGGGCCTGG + Intergenic
1198389948 X:136163605-136163627 CAGGGTTTGGCGATGGTTGCTGG + Intronic
1199951107 X:152706771-152706793 CAGTGTCTGGGGTAGGGGGCTGG + Intergenic
1199958577 X:152761690-152761712 CAGTGTCTGGGGTAGGGGGCTGG - Intergenic
1199965731 X:152819103-152819125 GTGTGTTTGGGGGTGGGGGCTGG - Intergenic
1201162434 Y:11177196-11177218 CAGTGAGTGAGGTTGGCGGCTGG + Intergenic
1202104660 Y:21350611-21350633 TAGTGTGTGGGGATGGGGGAGGG - Intergenic