ID: 957961307

View in Genome Browser
Species Human (GRCh38)
Location 3:87257048-87257070
Sequence GTTTGTCATTTCTACTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957961307_957961308 -2 Left 957961307 3:87257048-87257070 CCAAACTAGTAGAAATGACAAAC 0: 1
1: 0
2: 0
3: 21
4: 217
Right 957961308 3:87257069-87257091 ACATCTTTCTTCCATTTTAATGG 0: 1
1: 0
2: 3
3: 66
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957961307 Original CRISPR GTTTGTCATTTCTACTAGTT TGG (reversed) Intergenic
901909803 1:12447152-12447174 CTTTGTCAGTTCTGCTACTTGGG + Intronic
902213126 1:14917798-14917820 GTTTGTCTTCTCTCCTAGATTGG + Intronic
905138317 1:35818827-35818849 CTTTGTCATTTATTCTGGTTAGG + Intronic
906077127 1:43060181-43060203 GTTTTTTGTTTCTACTTGTTTGG + Intergenic
906942119 1:50264665-50264687 GCTTGTCATCTGTACTAGTCAGG - Intergenic
907495403 1:54840986-54841008 ATTTCTCATTTCTACTATTGAGG - Intronic
907982739 1:59500332-59500354 GTTTGTCATTCCAGCTTGTTAGG + Intronic
908117644 1:60955848-60955870 ATTTATCATGTCTACTAATTAGG - Intronic
910539392 1:88337898-88337920 GGTTGTCATGACTACTAGTTGGG - Intergenic
911307866 1:96253712-96253734 TTTTATCATTTTTACTAGTTTGG + Intergenic
911364354 1:96919130-96919152 GTTTGTCATTTCAACCAAGTGGG - Intergenic
913373265 1:118124381-118124403 GTTTGTCTCCTCTACTAGCTTGG + Intronic
915522232 1:156453911-156453933 GTTAGGCATTTCTTCCAGTTAGG + Intergenic
915965574 1:160304845-160304867 GTTTGTCAGTTCTACTCTTAAGG - Intronic
917011618 1:170480881-170480903 GTTTTTCAGCTCTATTAGTTTGG + Intergenic
918249694 1:182691146-182691168 GTTGGGCAATTCTTCTAGTTTGG - Intergenic
918690795 1:187476606-187476628 GTTTTTCATTTTTGCTATTTGGG + Intergenic
919044488 1:192433739-192433761 ATTTGTCATTTCTATGTGTTGGG - Intergenic
919095775 1:193033951-193033973 ATTGGTCATTTGTACTAGTGTGG + Intronic
919521210 1:198590737-198590759 GTTTTTTATTTCTACTTTTTAGG + Intergenic
920109813 1:203579622-203579644 CTTTGTCATTGTTAATAGTTTGG + Intergenic
921259462 1:213372584-213372606 CTTTGTCATTTAAAATAGTTTGG + Intergenic
921468197 1:215516941-215516963 ATTTATCATTTCTTTTAGTTAGG + Intergenic
921801691 1:219409977-219409999 GTTTTTCATTTTTACTCTTTCGG + Intergenic
922418134 1:225440526-225440548 GTTACTCAGTTCTGCTAGTTAGG - Intergenic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
924501605 1:244643575-244643597 GTTTGTCATTTCTTTGTGTTGGG + Intergenic
1063115889 10:3071385-3071407 GTTTGTTTTTTCTACTTGCTTGG + Intronic
1067264878 10:44732456-44732478 CTTTGTAATTTCTCCTTGTTAGG - Intergenic
1067334967 10:45353727-45353749 TTTTGTCATTTCTATGTGTTGGG - Intergenic
1067715445 10:48687054-48687076 GCTTTTCATTTCTACCAGATTGG - Intronic
1067896371 10:50184616-50184638 CTTTCTCTTTTTTACTAGTTGGG - Exonic
1067952605 10:50757411-50757433 CTTTCTCTTTTTTACTAGTTGGG + Intronic
1068531463 10:58191672-58191694 GTTTGTAATTTGTACTATTGTGG - Exonic
1068708136 10:60100103-60100125 AATTTTTATTTCTACTAGTTTGG + Intronic
1069219085 10:65860818-65860840 GTTTGGTATTTATACTACTTTGG - Intergenic
1072857691 10:98966791-98966813 ATTTATCATTTCTACGTGTTGGG - Intronic
1073074261 10:100813794-100813816 GTTTGTCATTGCTCCTGGTGAGG - Intronic
1073389190 10:103158136-103158158 CTTTGTGATTTCTATTATTTAGG - Intronic
1074955422 10:118383974-118383996 ATTTGTCATTTCCAGGAGTTTGG - Intergenic
1080216418 11:29846797-29846819 GTATGTCATTTCTGATAATTTGG - Intergenic
1080260760 11:30347396-30347418 GCTTGACATTTCTAGTAGCTAGG + Intergenic
1081379390 11:42395681-42395703 GCTTTTCAGTTCTACTAGTTTGG - Intergenic
1083500213 11:63098759-63098781 CTTTGTTACTTCTACTATTTTGG - Intronic
1084349415 11:68584530-68584552 GTTTATCATTATTACTAGTAAGG - Intronic
1084909941 11:72380380-72380402 CTTTGTGATTTCTTCTAGTGTGG - Exonic
1085664795 11:78404913-78404935 GTTTATCATTTCTTTTTGTTAGG - Intronic
1086372837 11:86172033-86172055 GTTTCTCATTTCTTCATGTTGGG - Intergenic
1087213373 11:95466742-95466764 GTTTTTCATTTCTCTTAGGTAGG + Intergenic
1087376436 11:97348014-97348036 ATTTATCATTTCTTCTTGTTAGG - Intergenic
1087620018 11:100529853-100529875 GTTTTTCAGTTCTATTAGTTTGG - Intergenic
1088197373 11:107290125-107290147 GTTTGTCACTTTTACATGTTGGG + Intergenic
1088233246 11:107695114-107695136 TTTTGTCAGTTCCAGTAGTTTGG - Intergenic
1089835318 11:121365368-121365390 GTTTGCTATTTCTGCTGGTTGGG + Intergenic
1089928481 11:122284306-122284328 GTTTGTCATTTCTATGTATTGGG + Intergenic
1090965465 11:131594188-131594210 ATTTGTCATTTGTAATAATTTGG + Intronic
1091535012 12:1398576-1398598 ATTTATCATTTCTTCTAGTCTGG - Intronic
1092056141 12:5509986-5510008 GTTTGTCTTTTTTACCACTTTGG + Intronic
1094318183 12:29155107-29155129 GTTTTTCATTTCTACTTCTTTGG + Intronic
1097594108 12:61606468-61606490 ATTTGTCATTTGTAACAGTTTGG + Intergenic
1097713988 12:62945755-62945777 ATTTGACATATCTACAAGTTAGG + Intergenic
1098118459 12:67207028-67207050 ATTTGTGATTTCTACATGTTGGG - Intergenic
1098283751 12:68887142-68887164 CTTCGTCATTTTTACTGGTTAGG - Intronic
1099107746 12:78518158-78518180 GTTTTTAATTTCTGCTGGTTGGG - Intergenic
1100234835 12:92650490-92650512 ATTTGTCATTTCTATATGTTAGG - Intergenic
1103179326 12:118895264-118895286 GTTTATCAGATCTACAAGTTTGG - Intergenic
1106601493 13:31191289-31191311 CTTTTCTATTTCTACTAGTTTGG + Intergenic
1106873726 13:34049433-34049455 GTTTATCATTTCTTCTAGTCTGG + Intergenic
1107772163 13:43799526-43799548 ATTTGTCATTTCTATGTGTTGGG + Intergenic
1107922497 13:45223898-45223920 GTAAGTTATTTCTAGTAGTTGGG + Intronic
1108710133 13:53025066-53025088 AGTTGCCATTTTTACTAGTTTGG + Intergenic
1110185188 13:72666016-72666038 TTTTATCATTCTTACTAGTTTGG - Intergenic
1111538758 13:89642162-89642184 GTTTATCATTTCTATGTGTTGGG + Intergenic
1116087246 14:40255718-40255740 GTTTTAGATTTATACTAGTTGGG + Intergenic
1118538751 14:66799569-66799591 CTTTGTCTCTTCTAATAGTTTGG + Intronic
1119059064 14:71455935-71455957 GTTTGACATCTTAACTAGTTTGG + Intronic
1120317509 14:82914697-82914719 GTATGTGTTTTCTACTAATTTGG - Intergenic
1123502141 15:20897640-20897662 ATTTTTTATTTCTGCTAGTTGGG - Intergenic
1123559391 15:21471324-21471346 ATTTTTTATTTCTGCTAGTTGGG - Intergenic
1123595626 15:21908621-21908643 ATTTTTTATTTCTGCTAGTTGGG - Intergenic
1123976151 15:25556258-25556280 CTTTGTCATTTCAACTAGGTGGG + Intergenic
1127241703 15:57123447-57123469 GTCTTTCATTTCTTCTAATTAGG + Intronic
1127486074 15:59419032-59419054 GTTTCTAATTTCTACAACTTAGG - Intronic
1128826807 15:70725872-70725894 GTTTATCATTTCTATGTGTTGGG - Intronic
1129358440 15:75008922-75008944 GTTTGTCATTTCTTATATCTGGG + Intronic
1129994793 15:79995164-79995186 GTTTTTCATTCCTACCACTTTGG - Intergenic
1130069503 15:80634659-80634681 TTTTGTCATTACTGCTGGTTCGG + Intergenic
1130181251 15:81631021-81631043 ATTTGTCTTTTCTTCTAATTAGG + Intergenic
1131923234 15:97353451-97353473 GTTGCTCATTGCTACTAATTTGG - Intergenic
1202967737 15_KI270727v1_random:198483-198505 ATTTTTTATTTCTGCTAGTTGGG - Intergenic
1140141895 16:72266135-72266157 ATTTGTCTTTTCAACTAGGTAGG - Intergenic
1140610899 16:76597740-76597762 GTTTATCATTTCTATGTGTTGGG + Intronic
1143366649 17:6413009-6413031 GGTGGTCATTGCTCCTAGTTTGG + Intronic
1143721557 17:8814615-8814637 CTTTGTCATTTCTTCAATTTTGG - Intronic
1146785119 17:35713127-35713149 GTCTGGCATTTCTCCTAGTGGGG + Intronic
1150144883 17:62760344-62760366 GTTTGTTATTTGAACTACTTTGG + Intronic
1150616970 17:66779830-66779852 GTTTTTAATTTCTACAAATTTGG - Intronic
1153178147 18:2402948-2402970 GTTTATCATTTCTATGTGTTGGG - Intergenic
1156423546 18:36982616-36982638 CTTTAACATTTCTACTAGTGTGG - Intronic
1157869515 18:51217300-51217322 GTTTGTCAATCCTATTAGATAGG - Intronic
1159495773 18:69202103-69202125 CTTGCTCATTTCTTCTAGTTGGG - Intergenic
1159529387 18:69636311-69636333 TTGTGTCATCTGTACTAGTTAGG - Intronic
1159866734 18:73714475-73714497 GTTTGACATTTCTACATATTAGG - Intergenic
1161463869 19:4416332-4416354 GCTCTTCACTTCTACTAGTTTGG + Intronic
1165890738 19:39110726-39110748 GTTTGTCATCTGTCCTAGCTAGG - Exonic
1168341840 19:55628752-55628774 GTTTATCATTTCTATGTGTTGGG - Intergenic
925061707 2:896705-896727 GTTTTTCTTTTCTACTACATGGG - Intergenic
926830188 2:16953457-16953479 CTATGTCATTTCTACTTGTTTGG + Intergenic
927012228 2:18915960-18915982 GTTTATCATTTTTACTTATTTGG - Intergenic
927158783 2:20239053-20239075 GTCTGTCATTGCTATTAATTTGG + Intergenic
927280145 2:21297745-21297767 AATTGTCATTTCTCCTGGTTAGG - Intergenic
927367709 2:22318364-22318386 GTTTACCCTTTCTACTGGTTTGG - Intergenic
931288436 2:60851718-60851740 TTTTGTCATTTCTATTACCTTGG + Intergenic
933562504 2:83906155-83906177 ATTTATCATTTCTATTTGTTGGG + Intergenic
937011430 2:118566170-118566192 CTTTTGCATTTCTACTAGCTTGG + Intergenic
941763792 2:169274024-169274046 ATGTGTCATTTCTAGTGGTTGGG + Intronic
942606320 2:177695302-177695324 ATTTATCATTTCTATTTGTTAGG + Intronic
942704791 2:178758454-178758476 GTTTAACATTTCTGTTAGTTGGG - Intronic
943341471 2:186687312-186687334 GTGTGTCATCTCTATTTGTTGGG - Intergenic
944715388 2:202372229-202372251 GTTTGGCATCTGTACTAATTAGG - Intergenic
946551878 2:220810663-220810685 TTTTGTCATTTAAACTAGTAAGG - Intergenic
947566261 2:231195804-231195826 CTTTTTAATTTCAACTAGTTTGG - Intergenic
948417407 2:237821606-237821628 ATTTGTCATTTCTATGTGTTAGG + Intronic
1168749760 20:274178-274200 GTGTGCCATTTCTACTTTTTAGG + Intronic
1170765538 20:19286812-19286834 ATTTGTCATTTCTAGTATTTCGG - Intronic
1170801929 20:19597549-19597571 ATTTATCATTTCTACATGTTGGG + Intronic
1170866012 20:20158893-20158915 GTATGTCAATTCTATTAGGTTGG + Intronic
1175053448 20:56176463-56176485 GTTTGTCATTTCTAATCTATTGG + Intergenic
1177374803 21:20255620-20255642 GTTTTTCATATCTACTAATTAGG - Intergenic
1178912965 21:36691270-36691292 TTTTTTCTTTTCTTCTAGTTAGG + Intergenic
1181428645 22:22862417-22862439 ATTTGTCATTTCTATATGTTGGG - Intronic
1182875805 22:33690197-33690219 TTTTGTCATTTCTACTTTTTGGG - Intronic
1183608083 22:38878648-38878670 CTTTGTGACTTCTACCAGTTGGG + Intergenic
951828369 3:26894888-26894910 GTTAGCCATTTTTACAAGTTTGG + Intergenic
952986620 3:38791309-38791331 GTATCTTTTTTCTACTAGTTTGG + Intronic
953592741 3:44275186-44275208 GTTTAACATTTCTATGAGTTGGG + Intronic
956900449 3:73709963-73709985 GTTTCTCATTTCTCCTAGCATGG + Intergenic
957512632 3:81209082-81209104 GTTTGTAGTTTCTAATATTTTGG - Intergenic
957961307 3:87257048-87257070 GTTTGTCATTTCTACTAGTTTGG - Intergenic
960013742 3:112861884-112861906 ATTTATCATTCCTACTTGTTAGG + Intergenic
961951056 3:130749510-130749532 ATTTGACATTTCAACTAGGTGGG - Intergenic
962704922 3:138033813-138033835 GTTTGTGGTTTCTGCAAGTTGGG + Intergenic
966952786 3:184838561-184838583 TTTTGTAATTTCTGTTAGTTGGG + Intronic
967771852 3:193342625-193342647 GTTTGTCATTTCTATTCCTCTGG + Intronic
970516660 4:16838257-16838279 GTTTTTAATTTCTCCTAATTAGG - Intronic
971912058 4:32806868-32806890 ATTTGTCATTTGTATTAGTCAGG - Intergenic
975416935 4:74115302-74115324 ATCTGTCATATCTATTAGTTTGG + Intronic
976080584 4:81350807-81350829 TTTTGTTCTTTCTACTATTTTGG - Intergenic
976403416 4:84635098-84635120 ATTTATCATTTCTACTGTTTTGG + Intronic
976758026 4:88519179-88519201 GTTTATAATTTTCACTAGTTAGG + Intergenic
979402935 4:120272819-120272841 TTTTGTCATTTCTACTTTTCTGG - Intergenic
980520940 4:133933598-133933620 TTTTGTCATTTCTACTCAATAGG + Intergenic
982998771 4:162385079-162385101 ATTTGTCATTTCTATGAGTTAGG - Intergenic
983372010 4:166872391-166872413 GTTTGTCATTGCTAGTGTTTAGG - Intronic
988436831 5:31185760-31185782 ATTTGTCATTTCCACGTGTTGGG - Intergenic
990051384 5:51505912-51505934 GTTTTTCATTTCTAAGAATTAGG + Intergenic
990747651 5:58977000-58977022 GTTTTTCACTTCTAGCAGTTTGG - Intronic
991211498 5:64110182-64110204 GTTTTTCATTTCCAATATTTAGG - Intergenic
991939396 5:71835913-71835935 GATTTACACTTCTACTAGTTGGG + Intergenic
991946900 5:71906802-71906824 TTTAGTTATTTTTACTAGTTAGG - Intergenic
992980627 5:82167777-82167799 GCCTCTCATTTCTACTACTTTGG + Intronic
993541007 5:89151496-89151518 ATTTGTCATTTCTATATGTTGGG + Intergenic
993769752 5:91911790-91911812 ATTTTCCATTTATACTAGTTTGG + Intergenic
993840169 5:92867853-92867875 TTTTGTCATTTTTTCTATTTAGG + Intergenic
994069147 5:95578945-95578967 GTTTTTCATTTGTATTAGTGAGG + Intronic
994359256 5:98831622-98831644 CTTAGTCATTTCTACTTATTTGG + Intergenic
994814439 5:104567366-104567388 GTTGTTCATTTTTACTATTTTGG - Intergenic
994935896 5:106253889-106253911 GTTTGTCATTATTACTTTTTTGG - Intergenic
996078969 5:119233513-119233535 GTTTATAAATTCCACTAGTTTGG + Intronic
996518248 5:124397474-124397496 GTCTGTCATTTTTATTACTTGGG + Intergenic
998715702 5:144881655-144881677 ATTTGTCATTTCTTTTAATTAGG - Intergenic
998864543 5:146484008-146484030 GGTAGTCATATCTATTAGTTGGG - Intronic
999120037 5:149202114-149202136 GGTTGTTATTTCCCCTAGTTTGG + Intronic
1000928490 5:167223157-167223179 ATTTATCATTTCTATTTGTTGGG + Intergenic
1001294054 5:170486386-170486408 GTTTGAAATTTCTGCCAGTTGGG - Intronic
1001357532 5:171044019-171044041 GTTTGACATTTCATCTAATTTGG + Intronic
1003300625 6:4878784-4878806 TTTCCTTATTTCTACTAGTTTGG + Intronic
1005083258 6:21978819-21978841 GTTTTTTATTTCTACTCATTAGG - Intergenic
1005234267 6:23741617-23741639 CTTTGCCATATCTACTACTTGGG - Intergenic
1008984182 6:57522115-57522137 GTTTGCCATTTATACTATTAGGG - Intronic
1009172239 6:60415009-60415031 GTTTGCCATTTATACTATTAGGG - Intergenic
1009467075 6:63984740-63984762 TTTTGTCACTTCTACTAGGTGGG + Intronic
1011964218 6:93133453-93133475 TTTTGTCATTACTACTAATCCGG - Intergenic
1013839398 6:114372354-114372376 GTTTGTCATTTTAAAGAGTTTGG - Intergenic
1014557405 6:122851146-122851168 GTTTCTGCTTTCTACCAGTTTGG - Intergenic
1014672942 6:124329505-124329527 GTTTCTCATTTCCACAAATTAGG - Intronic
1018057570 6:160065615-160065637 GTTTCTCATTTCTACTGGATGGG + Intronic
1018655594 6:166032691-166032713 GTGAGGCAGTTCTACTAGTTTGG + Intergenic
1022421211 7:30225275-30225297 CTGGGTCATTTCTACTTGTTAGG - Intergenic
1024156124 7:46627366-46627388 CTTTGTCCTTTCTACTCTTTTGG - Intergenic
1024398612 7:48897425-48897447 GGTTGTCTTTCCTTCTAGTTAGG + Intergenic
1024712514 7:52032889-52032911 GTTCATCATTTGTATTAGTTTGG - Intergenic
1027616021 7:80425098-80425120 GTATGTCAGATCTACGAGTTTGG + Intronic
1027754193 7:82189997-82190019 GTTTTTCATTTCAAATAATTAGG + Intronic
1028703738 7:93814062-93814084 GTTAGCCATTTGTATTAGTTAGG + Intronic
1030868087 7:114724006-114724028 ATTTGTCATTTCTATGTGTTGGG + Intergenic
1031251338 7:119386482-119386504 GTTTGTCATTACAACTGGTCAGG + Intergenic
1031272715 7:119673085-119673107 ATTTTTCTTTTCTACTATTTTGG - Intergenic
1031546476 7:123056308-123056330 CTTTATCAATTCTACTAATTTGG + Intergenic
1033014922 7:137661996-137662018 GCTTGTCATTTCTTCTAATTAGG - Intronic
1034507811 7:151509081-151509103 GTTTGTCATTCCTGCTTGCTGGG - Intronic
1036393775 8:8349079-8349101 CTTTCTCATATCTACTAGGTTGG + Intronic
1037170808 8:15889496-15889518 GGCTGTCATTTCTACTTGCTTGG + Intergenic
1039105683 8:33986862-33986884 ATTTGTCATTTCTACATGTTAGG + Intergenic
1039121309 8:34150877-34150899 ATTTATCATTTCTACTTGTCGGG - Intergenic
1039759231 8:40556811-40556833 TTTTATCATTTCTATTTGTTAGG + Intronic
1041633177 8:60111203-60111225 GTTTATCATTTCTATGTGTTGGG + Intergenic
1042870717 8:73396296-73396318 TTTTATTCTTTCTACTAGTTTGG - Intergenic
1044437533 8:92182768-92182790 GTATTTCATTTCGAGTAGTTTGG - Intergenic
1046046382 8:108969972-108969994 GTTTATCATTTCTATGTGTTGGG + Intergenic
1047043883 8:121030081-121030103 GTTTATCATTTCAACTACCTTGG + Intergenic
1047384063 8:124393357-124393379 GTTTTTCATTTCCAGAAGTTTGG + Intergenic
1047788822 8:128181486-128181508 GTCTGTCATTTATTCTGGTTTGG + Intergenic
1048795393 8:138144903-138144925 GTTTGTGATTTGTGCTAGTGAGG - Intronic
1051744490 9:20282128-20282150 TTTTGTCAGTTTTAATAGTTTGG - Intergenic
1052012177 9:23423232-23423254 ATTTATCATTTCTACGTGTTGGG - Intergenic
1055341433 9:75288246-75288268 GTTTTTCATTTCTATCAGGTTGG + Intergenic
1055583235 9:77730158-77730180 TTTTGTTTTTTCAACTAGTTGGG + Intronic
1056124634 9:83523035-83523057 GTCTGTCTTTTCTACTAGATTGG + Intronic
1056666252 9:88583009-88583031 GTTGGGCATTTCTTCTAGTTTGG + Intronic
1058172748 9:101702556-101702578 GTCTGTCATTTCTCTAAGTTTGG + Intronic
1058606869 9:106732275-106732297 GTTTTTTATTTCTATTATTTAGG - Intergenic
1058837799 9:108875062-108875084 GCCTGTCATTTCTACTGGTATGG + Intronic
1061026995 9:128056250-128056272 CTTTGTCATTGCTTCTGGTTGGG - Intergenic
1061245466 9:129399284-129399306 GTGTGTAATTTCAACTAGTTTGG + Intergenic
1061642834 9:131973103-131973125 GTTTATAATTTCTTCTAGGTAGG - Intronic
1186155928 X:6726438-6726460 GTTTATCATTTCTTCGTGTTGGG - Intergenic
1186198056 X:7129817-7129839 GTATGACATTTCTAGTAGTAAGG - Intronic
1186710184 X:12185834-12185856 GTTTGTGAATTCCACTACTTGGG + Intronic
1189406246 X:40727398-40727420 GTTTGTCATTGAAATTAGTTTGG - Intronic
1190796206 X:53745574-53745596 GTTTATCATTTCTATGTGTTGGG + Intergenic
1192105249 X:68309448-68309470 GTTCTTCATTTCTAGTACTTGGG - Intronic
1193356772 X:80528475-80528497 ATTTATCATTTCTACTGTTTTGG + Intergenic
1195207865 X:102621761-102621783 CTTTGTCATTTCTAATTGTTTGG + Intergenic
1196577880 X:117341651-117341673 ATTTGTCATTTCTATGAGTTAGG - Intergenic
1197258699 X:124292901-124292923 CTTTGTAATTTTTATTAGTTTGG + Intronic
1197586603 X:128355296-128355318 GTCTGTCTATGCTACTAGTTTGG - Intergenic
1199149354 X:144411503-144411525 ATTTATCATTTCTACCTGTTGGG + Intergenic
1202202634 Y:22369345-22369367 GTTTGACATTTCTACTTGGATGG - Intronic