ID: 957965724

View in Genome Browser
Species Human (GRCh38)
Location 3:87320984-87321006
Sequence AGGGAGAGTACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957965717_957965724 14 Left 957965717 3:87320947-87320969 CCATGTGGTGTGGAGAAGAAATC No data
Right 957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG No data
957965714_957965724 30 Left 957965714 3:87320931-87320953 CCACGACAGCTGCTGGCCATGTG No data
Right 957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957965724 Original CRISPR AGGGAGAGTACAGTGATTGT GGG Intergenic
No off target data available for this crispr