ID: 957966175

View in Genome Browser
Species Human (GRCh38)
Location 3:87324309-87324331
Sequence CAGCTCATACAGCTTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 7, 3: 23, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957966175_957966187 11 Left 957966175 3:87324309-87324331 CCAACACCAAGCTGTATGAGCTG 0: 1
1: 1
2: 7
3: 23
4: 139
Right 957966187 3:87324343-87324365 GCAGTGGGCCAAGCAGGACATGG No data
957966175_957966180 -5 Left 957966175 3:87324309-87324331 CCAACACCAAGCTGTATGAGCTG 0: 1
1: 1
2: 7
3: 23
4: 139
Right 957966180 3:87324327-87324349 AGCTGGGGCCCGCCCTGCAGTGG 0: 1
1: 0
2: 16
3: 52
4: 288
957966175_957966184 5 Left 957966175 3:87324309-87324331 CCAACACCAAGCTGTATGAGCTG 0: 1
1: 1
2: 7
3: 23
4: 139
Right 957966184 3:87324337-87324359 CGCCCTGCAGTGGGCCAAGCAGG No data
957966175_957966181 -4 Left 957966175 3:87324309-87324331 CCAACACCAAGCTGTATGAGCTG 0: 1
1: 1
2: 7
3: 23
4: 139
Right 957966181 3:87324328-87324350 GCTGGGGCCCGCCCTGCAGTGGG 0: 1
1: 0
2: 2
3: 44
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957966175 Original CRISPR CAGCTCATACAGCTTGGTGT TGG (reversed) Intergenic
900573645 1:3372331-3372353 GAGCTGATGCAGCTTGGGGTGGG - Intronic
901126115 1:6929994-6930016 CAGCATTTACAGCCTGGTGTAGG - Intronic
901330810 1:8406875-8406897 GAGCTCATACAACTTTGTGGAGG + Intronic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
903777694 1:25803650-25803672 CAGATCATACAGCTAGGTGGTGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912463104 1:109850456-109850478 CAGCCCATGCAGTTTGTTGTAGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
915832133 1:159140961-159140983 AAGCTCATCCAGCTTGCTGCTGG + Intronic
919402224 1:197133486-197133508 GAGCTTATACTGCTCGGTGTAGG - Exonic
919835135 1:201568183-201568205 CTGCTCCTCCAGCTTGGTGATGG + Intergenic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1064016124 10:11773693-11773715 CAGCTCACACAGGTAGTTGTCGG - Intergenic
1065738617 10:28776251-28776273 AAGCTCATACAGCCTGTAGTGGG - Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1074153835 10:110781634-110781656 CAGCTCATAGGGCTGGTTGTGGG - Exonic
1076923986 10:133472125-133472147 CAGCTCACACAGGCTGGTGATGG - Intergenic
1077108317 11:851336-851358 CAGCTCCTGCAGCTGGGAGTCGG + Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1082862082 11:57866571-57866593 CACCTCCTACTGCTTGGTCTTGG - Intergenic
1083668248 11:64286610-64286632 CAGGGCATACAGGGTGGTGTAGG - Exonic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1091722558 12:2823984-2824006 CAGCTCCTGCAGCATGCTGTGGG - Intronic
1091822077 12:3483034-3483056 CAGGTCACACAGCAAGGTGTGGG - Intronic
1091837315 12:3595028-3595050 AAGCTCATTCAACCTGGTGTAGG + Intergenic
1093337287 12:17921392-17921414 CCCCTCCTACAGCTGGGTGTTGG - Intergenic
1093567906 12:20630199-20630221 CAGCCCACGCAGCTTGGGGTAGG + Intronic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096581389 12:52587765-52587787 CAGCTCATCCAGCTTGGCCCGGG + Exonic
1096584440 12:52610749-52610771 CAGCTCATCCAGCTTGGCCCTGG + Exonic
1096593266 12:52676409-52676431 CAGGTCATTCAGCTTGTTCTTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1101124374 12:101615678-101615700 AATCACATACTGCTTGGTGTGGG - Intronic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1101522309 12:105495324-105495346 TAGCTCAAACAGCTGGGTGTTGG + Intergenic
1104225410 12:126827916-126827938 CAGCTCATTCGGCTTGCTGTGGG - Intergenic
1105281187 13:18963622-18963644 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1105290389 13:19049638-19049660 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1108722447 13:53146023-53146045 CAGCTCATAGAGCTCACTGTGGG - Intergenic
1109689920 13:65872878-65872900 CAACTCATCCAGGTTGGTATCGG - Intergenic
1112051703 13:95649497-95649519 CAGCTGTCACAGGTTGGTGTTGG + Intergenic
1115358361 14:32473836-32473858 CACCTCATACAGCTGGGTCATGG + Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1116950285 14:50872580-50872602 CAGATAATAGAGATTGGTGTAGG - Intronic
1124143554 15:27099087-27099109 CATCTCATTCATCTTGCTGTTGG - Intronic
1125670172 15:41466035-41466057 CAGCCCATATAGATTGATGTTGG + Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128488387 15:68120103-68120125 CAGGTCATCCAGCTTTGTTTTGG + Intronic
1128526910 15:68418774-68418796 GAGCTCAGACAGTTTGGTTTTGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1130582726 15:85153022-85153044 CAACTCACACTTCTTGGTGTGGG - Intergenic
1138654001 16:58480059-58480081 CACCTCCTACAGGTTGGTCTGGG - Intronic
1139243663 16:65419835-65419857 CAACTCATCCAGCTTGGGTTGGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1141744772 16:85918525-85918547 GGGCCCATACAGCTTGGTGCCGG - Exonic
1142898460 17:2997215-2997237 CTGCTCACCCAGCTTGGCGTAGG - Intronic
1143118388 17:4593159-4593181 CAGCTCATACCGCTAGGACTGGG - Exonic
1150514335 17:65791943-65791965 CAAGTCATGCAGCTAGGTGTTGG + Intronic
1150516378 17:65814291-65814313 CAGAGCAGACAGCTTGGTTTTGG - Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157580939 18:48773794-48773816 CAGCTCAGGCAGGTTGGTATGGG - Intronic
1160570228 18:79811625-79811647 CATCTGATTCAGCTTGATGTTGG - Intergenic
1160743162 19:696892-696914 CAGCTCACACAGCCGGGTGATGG + Intergenic
1162809443 19:13155250-13155272 CAGCTGATTCAGTTTGGTCTAGG - Intergenic
1163267048 19:16227782-16227804 CAGCTCATGGAGCGTGGGGTGGG - Intronic
1164435231 19:28222995-28223017 CAGCTCAAACAGCTCTGTGCTGG + Intergenic
1164478765 19:28595335-28595357 CAGATCTTACAGCTTGGGGCTGG + Intergenic
1164519498 19:28967735-28967757 GGGGTCATACAGCTTGGTGGAGG + Intergenic
1166068125 19:40371992-40372014 CAGCTCATTCTGCTTGGTCAGGG + Intronic
1166134905 19:40770288-40770310 GAGCTCATGGTGCTTGGTGTTGG + Intergenic
926577020 2:14593630-14593652 CAGTTTCTCCAGCTTGGTGTTGG - Intergenic
931920452 2:67009574-67009596 CATCTCATACAGGTTGGTGGGGG - Intergenic
935174419 2:100637398-100637420 CATCTGATTCATCTTGGTGTTGG + Intergenic
935250190 2:101253721-101253743 CACATCATACAGCTCAGTGTAGG + Intronic
935627124 2:105180594-105180616 CTGCTTTTACAGCTGGGTGTTGG + Intergenic
936049936 2:109214972-109214994 GAGCTCACACATCTTGGTGGAGG + Intronic
939169793 2:138681597-138681619 CAGCTCATTCAGCTTAGTCCTGG - Intronic
939480230 2:142739144-142739166 AAGCTGATACAGCATGGTGGAGG - Intergenic
941816650 2:169802368-169802390 CAGATCATATTGTTTGGTGTGGG + Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944420739 2:199527271-199527293 CAGCTCAGACAGGTCGATGTTGG - Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
1168892678 20:1305210-1305232 CGGGTCACTCAGCTTGGTGTAGG - Exonic
1171945717 20:31375614-31375636 CAGATCATAAACCTTGTTGTTGG + Intergenic
1173277165 20:41595358-41595380 CACCTCATACAGCTTAAGGTGGG + Intronic
1173383659 20:42568690-42568712 CAGCTCAGACAGCTCTCTGTAGG - Intronic
1175198686 20:57264004-57264026 CACCTCATACATCTTGGAGATGG + Intronic
1184341627 22:43889410-43889432 CAGCTCATGCAGGTTGGGGGAGG + Exonic
952064386 3:29550225-29550247 CTGCTGATACAACTTTGTGTTGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953896897 3:46809950-46809972 CAGCTGACACAGCCTGGAGTGGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
960286430 3:115834945-115834967 CAGGTGATACATCTTGGTCTTGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
965179830 3:165388264-165388286 TAGCCCACACAGCCTGGTGTTGG - Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
968359368 3:198136720-198136742 CAGCACAGACACCTCGGTGTAGG - Intergenic
971173824 4:24261910-24261932 TAGCACACACAGCTTGGTGGAGG - Intergenic
972680446 4:41301487-41301509 TAGCTCATACAGTATGATGTTGG + Intergenic
974061546 4:57040391-57040413 CATCACAAACAGCTTGGTGGGGG + Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
982337358 4:154255508-154255530 CAGCTCCTACAGGTTGGTCCAGG - Exonic
985695266 5:1336573-1336595 CAGCTCACACAGCTCTGTATGGG + Intronic
986548754 5:8929028-8929050 CAGCTCAGACAGCTGCATGTAGG + Intergenic
987455799 5:18144923-18144945 CAGCTCATACAACTTTATGGTGG + Intergenic
989086907 5:37685676-37685698 CAGCCAATAGAGTTTGGTGTGGG - Intronic
989617216 5:43349052-43349074 CAGCTCATGCAGTCTGGTGGTGG - Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991439596 5:66633310-66633332 CAGCTCATACAACCTGGAGGTGG - Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995805328 5:116045971-116045993 CAGCTGAAACAGCTTGGAGAGGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1001936274 5:175708092-175708114 CAGAACACACAGCTGGGTGTGGG + Intergenic
1001984135 5:176059822-176059844 CAGCTCTTTCAGCATGGTGCAGG - Intronic
1002233342 5:177784243-177784265 CAGCTCTTTCAGCATGGTGCAGG + Intronic
1002369744 5:178742175-178742197 CAGCCCCCACAGCCTGGTGTTGG - Intergenic
1002501209 5:179648853-179648875 CAGCTCCTACAGGCTGGGGTGGG + Intergenic
1002939092 6:1700077-1700099 GAGCTCATACACTTTGGTGTCGG - Intronic
1006836472 6:37002037-37002059 CAGATCATACATGTTGATGTGGG - Intergenic
1009752977 6:67896516-67896538 CAGCCCATACAGCATTGTGGTGG - Intergenic
1010515559 6:76769314-76769336 CAGCTCACACATCTGGGTGGGGG - Intergenic
1013760240 6:113509990-113510012 CAGCTGCTCCAGATTGGTGTTGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015626485 6:135183941-135183963 CAAGTCATACAGCTAGGTGGAGG + Intronic
1015794546 6:136997942-136997964 CAGTTCATAAACCTTGGTGTAGG - Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019204748 6:170350515-170350537 CACCTCCTACAGGTGGGTGTGGG + Intronic
1019260627 7:79956-79978 CAGCACAGACACCTCGGTGTAGG + Intergenic
1019427534 7:984553-984575 CAGCTCATCCAGCGAGGTGGAGG + Exonic
1023223718 7:37947766-37947788 AAGCTGAGACATCTTGGTGTTGG - Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024126024 7:46295382-46295404 CAGCTCTTTAATCTTGGTGTGGG - Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1029994319 7:104991955-104991977 CACCTCAAACATCTTTGTGTTGG - Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1032428143 7:131838260-131838282 CAGCAAATGCTGCTTGGTGTGGG - Intergenic
1034490647 7:151391502-151391524 CAGCTCACCCAGCTGCGTGTGGG - Intronic
1038878216 8:31576030-31576052 CAGCTCCTACAACTTTGTGTGGG - Intergenic
1039988380 8:42467115-42467137 CAGCCCATACTGCTTGTTGATGG + Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1049724495 8:144139300-144139322 AAGCTCATCCAGGTTGGTGCAGG + Exonic
1056711281 9:88993906-88993928 CAGCTCACACAGCGAGGTGACGG + Exonic
1057834902 9:98436662-98436684 CAGCTCATTTAGCTTGCTGGGGG - Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058643266 9:107107502-107107524 CAGCTCACAGAGTGTGGTGTTGG - Intergenic
1061504729 9:131025443-131025465 CAGATCCTCCAGCTGGGTGTCGG + Intronic
1062744055 9:138200434-138200456 CAGCACAGACACCTCGGTGTAGG - Intergenic
1186716182 X:12254406-12254428 CAGCTGAAACAGCTTGCTTTGGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1192676900 X:73206590-73206612 CAGCTGAGTCATCTTGGTGTTGG - Intergenic
1192953515 X:76043790-76043812 CAACTCATGCAGATAGGTGTTGG + Intergenic
1194583443 X:95704804-95704826 CAGCACCTTCAGCCTGGTGTGGG + Intergenic
1195151659 X:102077423-102077445 AAGGTCATACAGCATGGAGTGGG - Intergenic
1195196743 X:102504410-102504432 CATCTAATTCATCTTGGTGTTGG + Intergenic
1196725692 X:118893089-118893111 CATCTAATTCATCTTGGTGTTGG - Intergenic
1196812141 X:119637092-119637114 CAGCTCATAGTGCCGGGTGTGGG + Exonic
1200141976 X:153906959-153906981 CAGCTCACTGAGCTGGGTGTAGG + Exonic
1200272701 X:154701090-154701112 CAGCTAATACATGGTGGTGTAGG - Intronic