ID: 957967299

View in Genome Browser
Species Human (GRCh38)
Location 3:87338895-87338917
Sequence CTGTGTGACCCAAGGCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957967299_957967301 -6 Left 957967299 3:87338895-87338917 CCAATTTGCCTTGGGTCACACAG No data
Right 957967301 3:87338912-87338934 ACACAGAAATAAGAGCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957967299 Original CRISPR CTGTGTGACCCAAGGCAAAT TGG (reversed) Intergenic
No off target data available for this crispr