ID: 957971492

View in Genome Browser
Species Human (GRCh38)
Location 3:87388436-87388458
Sequence CACCTTGCTGTGTCATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957971488_957971492 -1 Left 957971488 3:87388414-87388436 CCCTACCTGTTTTACAGACGGCC No data
Right 957971492 3:87388436-87388458 CACCTTGCTGTGTCATCACATGG No data
957971486_957971492 12 Left 957971486 3:87388401-87388423 CCTGGTGAAGACTCCCTACCTGT No data
Right 957971492 3:87388436-87388458 CACCTTGCTGTGTCATCACATGG No data
957971490_957971492 -6 Left 957971490 3:87388419-87388441 CCTGTTTTACAGACGGCCACCTT No data
Right 957971492 3:87388436-87388458 CACCTTGCTGTGTCATCACATGG No data
957971489_957971492 -2 Left 957971489 3:87388415-87388437 CCTACCTGTTTTACAGACGGCCA No data
Right 957971492 3:87388436-87388458 CACCTTGCTGTGTCATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957971492 Original CRISPR CACCTTGCTGTGTCATCACA TGG Intergenic
No off target data available for this crispr