ID: 957971775

View in Genome Browser
Species Human (GRCh38)
Location 3:87391111-87391133
Sequence GCCACTCTCTGAGCTGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957971775_957971778 14 Left 957971775 3:87391111-87391133 CCAGTACCAGCTCAGAGAGTGGC No data
Right 957971778 3:87391148-87391170 AGATAACAATCACTACAGCTTGG 0: 30
1: 70
2: 85
3: 194
4: 378
957971775_957971779 22 Left 957971775 3:87391111-87391133 CCAGTACCAGCTCAGAGAGTGGC No data
Right 957971779 3:87391156-87391178 ATCACTACAGCTTGGCTCTCAGG 0: 19
1: 73
2: 182
3: 358
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957971775 Original CRISPR GCCACTCTCTGAGCTGGTAC TGG (reversed) Intergenic
No off target data available for this crispr