ID: 957975501

View in Genome Browser
Species Human (GRCh38)
Location 3:87438478-87438500
Sequence TTGTATATGCACAAAGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957975501_957975502 15 Left 957975501 3:87438478-87438500 CCTTGCACTTTGTGCATATACAA No data
Right 957975502 3:87438516-87438538 TACTGAAATTATGCTATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957975501 Original CRISPR TTGTATATGCACAAAGTGCA AGG (reversed) Intergenic
No off target data available for this crispr