ID: 957976229

View in Genome Browser
Species Human (GRCh38)
Location 3:87448189-87448211
Sequence AGGAAGAGTAGAGTGATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957976229_957976239 30 Left 957976229 3:87448189-87448211 CCCAAAATCACTCTACTCTTCCT No data
Right 957976239 3:87448242-87448264 ATGACAGGTGCCACTGTTGGAGG No data
957976229_957976234 15 Left 957976229 3:87448189-87448211 CCCAAAATCACTCTACTCTTCCT No data
Right 957976234 3:87448227-87448249 ATTATCTCTCCCCACATGACAGG No data
957976229_957976238 27 Left 957976229 3:87448189-87448211 CCCAAAATCACTCTACTCTTCCT No data
Right 957976238 3:87448239-87448261 CACATGACAGGTGCCACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957976229 Original CRISPR AGGAAGAGTAGAGTGATTTT GGG (reversed) Intergenic
No off target data available for this crispr