ID: 957984679

View in Genome Browser
Species Human (GRCh38)
Location 3:87558630-87558652
Sequence CTCTAAGGTTCTCTCTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957984679_957984684 17 Left 957984679 3:87558630-87558652 CCAGACAAGAGAGAACCTTAGAG No data
Right 957984684 3:87558670-87558692 ACACAGATTTTCTCTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957984679 Original CRISPR CTCTAAGGTTCTCTCTTGTC TGG (reversed) Intergenic