ID: 957984679 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:87558630-87558652 |
Sequence | CTCTAAGGTTCTCTCTTGTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
957984679_957984684 | 17 | Left | 957984679 | 3:87558630-87558652 | CCAGACAAGAGAGAACCTTAGAG | No data | ||
Right | 957984684 | 3:87558670-87558692 | ACACAGATTTTCTCTACAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
957984679 | Original CRISPR | CTCTAAGGTTCTCTCTTGTC TGG (reversed) | Intergenic | ||