ID: 957984682

View in Genome Browser
Species Human (GRCh38)
Location 3:87558645-87558667
Sequence ACACAGCCGGCCTTTCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957984682_957984684 2 Left 957984682 3:87558645-87558667 CCTTAGAGAAAGGCCGGCTGTGT No data
Right 957984684 3:87558670-87558692 ACACAGATTTTCTCTACAGATGG No data
957984682_957984685 21 Left 957984682 3:87558645-87558667 CCTTAGAGAAAGGCCGGCTGTGT No data
Right 957984685 3:87558689-87558711 ATGGAAATCTCCTCCACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957984682 Original CRISPR ACACAGCCGGCCTTTCTCTA AGG (reversed) Intergenic
No off target data available for this crispr