ID: 957984684

View in Genome Browser
Species Human (GRCh38)
Location 3:87558670-87558692
Sequence ACACAGATTTTCTCTACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957984679_957984684 17 Left 957984679 3:87558630-87558652 CCAGACAAGAGAGAACCTTAGAG No data
Right 957984684 3:87558670-87558692 ACACAGATTTTCTCTACAGATGG No data
957984682_957984684 2 Left 957984682 3:87558645-87558667 CCTTAGAGAAAGGCCGGCTGTGT No data
Right 957984684 3:87558670-87558692 ACACAGATTTTCTCTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957984684 Original CRISPR ACACAGATTTTCTCTACAGA TGG Intergenic