ID: 957984685

View in Genome Browser
Species Human (GRCh38)
Location 3:87558689-87558711
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957984682_957984685 21 Left 957984682 3:87558645-87558667 CCTTAGAGAAAGGCCGGCTGTGT No data
Right 957984685 3:87558689-87558711 ATGGAAATCTCCTCCACAACAGG No data
957984683_957984685 8 Left 957984683 3:87558658-87558680 CCGGCTGTGTCAACACAGATTTT No data
Right 957984685 3:87558689-87558711 ATGGAAATCTCCTCCACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type