ID: 958004708

View in Genome Browser
Species Human (GRCh38)
Location 3:87796072-87796094
Sequence GTTTCTGTTGGAAGACAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958004703_958004708 7 Left 958004703 3:87796042-87796064 CCCCAATAACTTCTTGCTATTCT No data
Right 958004708 3:87796072-87796094 GTTTCTGTTGGAAGACAAGAAGG No data
958004704_958004708 6 Left 958004704 3:87796043-87796065 CCCAATAACTTCTTGCTATTCTG No data
Right 958004708 3:87796072-87796094 GTTTCTGTTGGAAGACAAGAAGG No data
958004705_958004708 5 Left 958004705 3:87796044-87796066 CCAATAACTTCTTGCTATTCTGT No data
Right 958004708 3:87796072-87796094 GTTTCTGTTGGAAGACAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958004708 Original CRISPR GTTTCTGTTGGAAGACAAGA AGG Intergenic
No off target data available for this crispr