ID: 958016459

View in Genome Browser
Species Human (GRCh38)
Location 3:87944239-87944261
Sequence ATGCATCTTGATGGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958016459_958016467 26 Left 958016459 3:87944239-87944261 CCCAGCTCCCCATCAAGATGCAT No data
Right 958016467 3:87944288-87944310 ATTCATTTCAGAGAGGATGTAGG No data
958016459_958016466 19 Left 958016459 3:87944239-87944261 CCCAGCTCCCCATCAAGATGCAT No data
Right 958016466 3:87944281-87944303 TATGCAAATTCATTTCAGAGAGG 0: 34
1: 32
2: 19
3: 43
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958016459 Original CRISPR ATGCATCTTGATGGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr