ID: 958016753

View in Genome Browser
Species Human (GRCh38)
Location 3:87946330-87946352
Sequence TGTATGGGAGCTCTGTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958016753_958016762 -1 Left 958016753 3:87946330-87946352 CCTGAAAACAGAGCTCCCATACA No data
Right 958016762 3:87946352-87946374 AAAGGGAGGGGCCCCAAAGAGGG No data
958016753_958016761 -2 Left 958016753 3:87946330-87946352 CCTGAAAACAGAGCTCCCATACA No data
Right 958016761 3:87946351-87946373 CAAAGGGAGGGGCCCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958016753 Original CRISPR TGTATGGGAGCTCTGTTTTC AGG (reversed) Intergenic
No off target data available for this crispr