ID: 958018921

View in Genome Browser
Species Human (GRCh38)
Location 3:87974016-87974038
Sequence ATGAGCCACCAGTGCCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958018917_958018921 -6 Left 958018917 3:87973999-87974021 CCCAGAGACAAGTCCCAATGAGC No data
Right 958018921 3:87974016-87974038 ATGAGCCACCAGTGCCAATTTGG No data
958018918_958018921 -7 Left 958018918 3:87974000-87974022 CCAGAGACAAGTCCCAATGAGCC No data
Right 958018921 3:87974016-87974038 ATGAGCCACCAGTGCCAATTTGG No data
958018916_958018921 0 Left 958018916 3:87973993-87974015 CCAGCACCCAGAGACAAGTCCCA No data
Right 958018921 3:87974016-87974038 ATGAGCCACCAGTGCCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958018921 Original CRISPR ATGAGCCACCAGTGCCAATT TGG Intergenic
No off target data available for this crispr