ID: 958019100

View in Genome Browser
Species Human (GRCh38)
Location 3:87977081-87977103
Sequence ATATGTAAGGGGATGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958019100_958019108 21 Left 958019100 3:87977081-87977103 CCTCCCACCATCCCCTTACATAT No data
Right 958019108 3:87977125-87977147 ATTAGACAGTGATGGTACTATGG No data
958019100_958019107 13 Left 958019100 3:87977081-87977103 CCTCCCACCATCCCCTTACATAT No data
Right 958019107 3:87977117-87977139 AACTTGATATTAGACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958019100 Original CRISPR ATATGTAAGGGGATGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr