ID: 958019107

View in Genome Browser
Species Human (GRCh38)
Location 3:87977117-87977139
Sequence AACTTGATATTAGACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958019104_958019107 2 Left 958019104 3:87977092-87977114 CCCCTTACATATTGTAGAATTAG No data
Right 958019107 3:87977117-87977139 AACTTGATATTAGACAGTGATGG No data
958019100_958019107 13 Left 958019100 3:87977081-87977103 CCTCCCACCATCCCCTTACATAT No data
Right 958019107 3:87977117-87977139 AACTTGATATTAGACAGTGATGG No data
958019101_958019107 10 Left 958019101 3:87977084-87977106 CCCACCATCCCCTTACATATTGT No data
Right 958019107 3:87977117-87977139 AACTTGATATTAGACAGTGATGG No data
958019106_958019107 0 Left 958019106 3:87977094-87977116 CCTTACATATTGTAGAATTAGAA No data
Right 958019107 3:87977117-87977139 AACTTGATATTAGACAGTGATGG No data
958019103_958019107 6 Left 958019103 3:87977088-87977110 CCATCCCCTTACATATTGTAGAA No data
Right 958019107 3:87977117-87977139 AACTTGATATTAGACAGTGATGG No data
958019105_958019107 1 Left 958019105 3:87977093-87977115 CCCTTACATATTGTAGAATTAGA No data
Right 958019107 3:87977117-87977139 AACTTGATATTAGACAGTGATGG No data
958019102_958019107 9 Left 958019102 3:87977085-87977107 CCACCATCCCCTTACATATTGTA No data
Right 958019107 3:87977117-87977139 AACTTGATATTAGACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958019107 Original CRISPR AACTTGATATTAGACAGTGA TGG Intergenic
No off target data available for this crispr