ID: 958019108

View in Genome Browser
Species Human (GRCh38)
Location 3:87977125-87977147
Sequence ATTAGACAGTGATGGTACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958019103_958019108 14 Left 958019103 3:87977088-87977110 CCATCCCCTTACATATTGTAGAA No data
Right 958019108 3:87977125-87977147 ATTAGACAGTGATGGTACTATGG No data
958019106_958019108 8 Left 958019106 3:87977094-87977116 CCTTACATATTGTAGAATTAGAA No data
Right 958019108 3:87977125-87977147 ATTAGACAGTGATGGTACTATGG No data
958019100_958019108 21 Left 958019100 3:87977081-87977103 CCTCCCACCATCCCCTTACATAT No data
Right 958019108 3:87977125-87977147 ATTAGACAGTGATGGTACTATGG No data
958019104_958019108 10 Left 958019104 3:87977092-87977114 CCCCTTACATATTGTAGAATTAG No data
Right 958019108 3:87977125-87977147 ATTAGACAGTGATGGTACTATGG No data
958019102_958019108 17 Left 958019102 3:87977085-87977107 CCACCATCCCCTTACATATTGTA No data
Right 958019108 3:87977125-87977147 ATTAGACAGTGATGGTACTATGG No data
958019105_958019108 9 Left 958019105 3:87977093-87977115 CCCTTACATATTGTAGAATTAGA No data
Right 958019108 3:87977125-87977147 ATTAGACAGTGATGGTACTATGG No data
958019101_958019108 18 Left 958019101 3:87977084-87977106 CCCACCATCCCCTTACATATTGT No data
Right 958019108 3:87977125-87977147 ATTAGACAGTGATGGTACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958019108 Original CRISPR ATTAGACAGTGATGGTACTA TGG Intergenic
No off target data available for this crispr