ID: 958021955

View in Genome Browser
Species Human (GRCh38)
Location 3:88008360-88008382
Sequence TGGGATTGCCTTGCAGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958021955_958021958 -3 Left 958021955 3:88008360-88008382 CCAGTGTCTGCAAGGCAATCCCA No data
Right 958021958 3:88008380-88008402 CCAAGCAAAAAGAACAAAGCTGG 0: 99
1: 4491
2: 15517
3: 7089
4: 4123
958021955_958021959 0 Left 958021955 3:88008360-88008382 CCAGTGTCTGCAAGGCAATCCCA No data
Right 958021959 3:88008383-88008405 AGCAAAAAGAACAAAGCTGGAGG 0: 4275
1: 15501
2: 7334
3: 4236
4: 3694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958021955 Original CRISPR TGGGATTGCCTTGCAGACAC TGG (reversed) Intergenic
No off target data available for this crispr