ID: 958028083

View in Genome Browser
Species Human (GRCh38)
Location 3:88072750-88072772
Sequence CTGATGCTTTCATTTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 945
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 873}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958028083_958028085 -3 Left 958028083 3:88072750-88072772 CCACAAAAAAATGAAAGCATCAG 0: 1
1: 0
2: 3
3: 68
4: 873
Right 958028085 3:88072770-88072792 CAGTGAACTTGGTACACAGTAGG 0: 1
1: 0
2: 2
3: 39
4: 383
958028083_958028086 7 Left 958028083 3:88072750-88072772 CCACAAAAAAATGAAAGCATCAG 0: 1
1: 0
2: 3
3: 68
4: 873
Right 958028086 3:88072780-88072802 GGTACACAGTAGGCACTCTAAGG 0: 1
1: 0
2: 2
3: 19
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958028083 Original CRISPR CTGATGCTTTCATTTTTTTG TGG (reversed) Intronic
901410620 1:9080906-9080928 CTGATCCTTTCAATTATTTCAGG + Intronic
901851159 1:12016762-12016784 CAGATGTTTTCATTTTTTGTAGG + Intergenic
902591518 1:17478369-17478391 CTTTTTCTTTCTTTTTTTTGGGG + Intergenic
902680486 1:18040729-18040751 CTGATACTTACCTTTTTGTGGGG - Intergenic
902780126 1:18699561-18699583 CTGATTTTTTTTTTTTTTTGAGG + Intronic
902794278 1:18790943-18790965 CTGATTTTTTTTTTTTTTTGAGG - Intergenic
903114189 1:21164855-21164877 CTTATCTTTTCATTTTCTTGAGG - Intronic
903567850 1:24282443-24282465 CTAATTTTTTCATTTTTTTGTGG + Intergenic
903693066 1:25187804-25187826 CATATGCTTTCATTTTTCTTGGG - Intergenic
904143709 1:28373121-28373143 CTAATTTTTTAATTTTTTTGTGG + Intronic
905129703 1:35744747-35744769 GTCCTGCTTTCACTTTTTTGGGG + Intronic
905142922 1:35862851-35862873 CTAATTTTTTAATTTTTTTGTGG - Intergenic
905144044 1:35872735-35872757 CTAATTTTTTAATTTTTTTGTGG + Intronic
905529154 1:38662728-38662750 CTGTTTCTTTCATTTTTGGGGGG + Intergenic
905673348 1:39807849-39807871 CTGGTTCTTGCATTTTTTGGTGG + Intergenic
906583226 1:46953515-46953537 CAGATGCATTCAATCTTTTGCGG + Intergenic
906769051 1:48467408-48467430 CTGATTTTTTCTTCTTTTTGTGG - Intronic
906901449 1:49841258-49841280 CTGTGTATTTCATTTTTTTGTGG - Intronic
907786108 1:57614473-57614495 ATGAAGCTTTCACTGTTTTGTGG + Intronic
907827139 1:58029408-58029430 CTGCTGTGTTGATTTTTTTGTGG - Intronic
908222091 1:62017410-62017432 CTGATTTTTTTTTTTTTTTGAGG - Intronic
908379803 1:63586324-63586346 CAGATGCTTTAATTTTATGGAGG - Intronic
909055251 1:70813359-70813381 CTGATGCTCTAATTTTTATGTGG - Intergenic
909184350 1:72466927-72466949 ATCTTTCTTTCATTTTTTTGAGG + Intergenic
909401873 1:75242340-75242362 CTGAGTCTCTGATTTTTTTGTGG + Intronic
909803568 1:79846304-79846326 ATGATGTTTTCATTTTGTTTTGG - Intergenic
910738061 1:90484085-90484107 ATCTTGCTTTCAATTTTTTGGGG - Intergenic
911191322 1:94951504-94951526 CAGATGCTTTCAATTGTTTATGG - Intergenic
911293134 1:96081642-96081664 CTGTTGCTTTCCTTTTTTATAGG - Intergenic
911607827 1:99928558-99928580 CTGATTTTTAAATTTTTTTGTGG - Intergenic
911892994 1:103396502-103396524 CTGATTCTTTCTCATTTTTGTGG + Intergenic
912267877 1:108177316-108177338 CTCTTGCTGTCTTTTTTTTGTGG - Intronic
912349887 1:109001888-109001910 CTGCTGCTTTTTTTTTTTTGAGG - Intronic
913653065 1:120936687-120936709 CTGAACCTTTCATTTATTTCAGG + Intergenic
914168039 1:145192353-145192375 CTGAACCTTTCATTTATTTCAGG - Intergenic
914324143 1:146595050-146595072 ATGATTCTTTCATGTTTTTCAGG + Intergenic
914518756 1:148396772-148396794 CTGAACCTTTCATTTATTTCAGG + Intergenic
914687027 1:149989470-149989492 CTGAGGCTTTTTTTTTTTTTTGG - Intronic
914761971 1:150606256-150606278 CTAATTTTTTAATTTTTTTGTGG + Intronic
915135048 1:153725551-153725573 TTTATGCTTCCATTTGTTTGTGG - Intergenic
915495336 1:156278529-156278551 CTGATTTTTTAATTTTTTTGTGG + Intronic
916193188 1:162198684-162198706 CTGATTCTTTCATTATCTCGTGG + Intronic
916340875 1:163732651-163732673 CATATGCTTTCATTTTTTACTGG + Intergenic
916544398 1:165788658-165788680 ATGATTCTCTCATTTTTGTGTGG + Intronic
917134033 1:171771303-171771325 CTGAGGATTTCGATTTTTTGAGG + Intergenic
917352148 1:174089610-174089632 CTGATTCTTTCTTTTCTTTGTGG + Intergenic
917543589 1:175938703-175938725 CTAATTCTTTTAATTTTTTGTGG - Intergenic
917730994 1:177874715-177874737 CTGATTTTTGTATTTTTTTGTGG - Intergenic
917903277 1:179564793-179564815 CTTTTGCTTTAATTTTTTTAAGG - Exonic
917935061 1:179858429-179858451 CAGATGTTTTTATTTTTTTAAGG - Intronic
918257347 1:182761273-182761295 CTGTTTCTTTTTTTTTTTTGAGG + Intergenic
918277034 1:182962982-182963004 GTGATTCTTTCTTTTTTGTGTGG - Intergenic
918407700 1:184226804-184226826 TTAATGTTTGCATTTTTTTGTGG - Intergenic
918653624 1:186997272-186997294 CTGAGGTTTGCATTCTTTTGAGG + Intergenic
918739049 1:188103663-188103685 GTCTTGCTTTCATTGTTTTGAGG + Intergenic
918948210 1:191098681-191098703 CTTTTGCTTTCCTTTTTTGGAGG - Intergenic
919004862 1:191884407-191884429 CTGGTTCTTTCATGTTTTGGGGG - Intergenic
919460831 1:197874903-197874925 CTCCTGCTTTCAATTATTTGGGG + Intergenic
920205856 1:204291431-204291453 CATATGCTTTCCTTTTTTTTGGG - Intronic
920720800 1:208385025-208385047 CTGATGAGTCCATTTTTCTGTGG - Intergenic
921522390 1:216172692-216172714 CTGATGCCTACATGTCTTTGGGG + Intronic
922979730 1:229815401-229815423 CTGATCCTTTCAATTATTTTGGG - Intergenic
923058285 1:230446238-230446260 GTGGTGATTTCATCTTTTTGGGG - Intergenic
923357817 1:233177804-233177826 CTGAATCTTTCATCTTCTTGGGG + Exonic
923485132 1:234422498-234422520 CTCATGTTTTCACTTATTTGTGG + Intronic
923699485 1:236286298-236286320 CTGTTCATTTCCTTTTTTTGGGG + Intergenic
924139678 1:241009425-241009447 CTGACTCTTTCATTTATTTCAGG + Intronic
924941506 1:248815489-248815511 ATGATGCTTTCATGTCTTGGGGG + Intronic
1062970356 10:1643513-1643535 CTGTTGCTTTTGTTTTTTGGGGG - Intronic
1062995274 10:1859680-1859702 ATGATTCTTTCTTGTTTTTGAGG - Intergenic
1063049306 10:2429490-2429512 CTTATGTTTTCATTTCTTTGGGG - Intergenic
1063153023 10:3354056-3354078 TTCCTGCTTTCAATTTTTTGGGG + Intergenic
1063335153 10:5205468-5205490 CTGATCCTATAATTTTTTTGGGG - Intronic
1063470976 10:6285070-6285092 CTCCTGCTTTCAGTTCTTTGGGG + Intergenic
1064595678 10:16942732-16942754 TTCATGCTTTCATTTCATTGGGG - Intronic
1064831808 10:19476958-19476980 CTAATGTTTTCATTTTTTCCAGG + Intronic
1064971080 10:21067813-21067835 CTGATGTTTTAATTTTTTTTTGG - Intronic
1065231612 10:23604445-23604467 GTAATGCTTTCATTTTTTGGAGG - Intergenic
1065668662 10:28089894-28089916 CTGAGGGTTTTTTTTTTTTGAGG - Intronic
1065709415 10:28501101-28501123 CTGATGCTTCCATTTTGAAGTGG + Intergenic
1065927036 10:30444022-30444044 CTGACTTTTTTATTTTTTTGTGG - Intronic
1066094207 10:32056876-32056898 GTGTTGCTTTCATTTTTGTCTGG + Intergenic
1066728024 10:38411617-38411639 CATATTCTTTCTTTTTTTTGAGG - Intergenic
1066762533 10:38769236-38769258 CTGATGGTAACATTTTTTTCAGG - Intergenic
1067065682 10:43102846-43102868 CTGCAGCTTTCATTCTTGTGGGG + Intronic
1067759470 10:49032932-49032954 CTGATTCTTTTTTTTTTTTTTGG + Intronic
1068756913 10:60666066-60666088 ATCCTGCTTTCAATTTTTTGGGG - Intronic
1069038983 10:63674689-63674711 CTTATGCTTTCAGTTTATAGGGG - Intergenic
1069089174 10:64178505-64178527 CTGATGCTAACATTTTTATCAGG + Intergenic
1069097429 10:64276473-64276495 CTTATGGTTTTTTTTTTTTGTGG + Intergenic
1069315270 10:67091489-67091511 CTTTTGTTTTCCTTTTTTTGGGG - Intronic
1069602797 10:69719027-69719049 CAAATGCTTTCATTTTTCTTGGG + Intergenic
1070002241 10:72387765-72387787 CTGGTGCTTTTTTTTTTTTAAGG + Intronic
1070279080 10:75035826-75035848 CTCATGCTCTCATCTCTTTGTGG - Intergenic
1071108847 10:82130523-82130545 ATACTGATTTCATTTTTTTGGGG + Intronic
1071151545 10:82640886-82640908 CAAATGCTTACATTCTTTTGAGG + Intronic
1071216995 10:83417058-83417080 CTGTAGTTTTCATTTTTTTGTGG + Intergenic
1071221331 10:83468700-83468722 CACATGTTTTCATTTATTTGTGG + Intergenic
1071599208 10:86948788-86948810 CTAATTTTTTAATTTTTTTGTGG - Intronic
1071833257 10:89393135-89393157 CTGAGGCTTTCACATTCTTGTGG - Intronic
1071929244 10:90448008-90448030 CATATGCTTTCATTTATTTTGGG - Intergenic
1072142549 10:92601910-92601932 ATGTTGCTTTTATTTTGTTGAGG + Intronic
1073571163 10:104582190-104582212 CTAATGCTTTTTTTTTCTTGAGG - Intergenic
1073600796 10:104844195-104844217 GTCATGCTTTCATTTGTTCGAGG - Intronic
1073876996 10:107936398-107936420 CAGGTACTTTCATTTTTTTATGG - Intergenic
1073925630 10:108511852-108511874 CTAATGTTTTAATTTTTATGTGG - Intergenic
1073939360 10:108677414-108677436 CTGGTGATTTTATTTTTTTATGG + Intergenic
1074447488 10:113532710-113532732 CTGATGCCTTCGTTTTATTTGGG - Intergenic
1074542982 10:114381026-114381048 CATATGCTTTCATTTTTCTTGGG - Intronic
1074713822 10:116200198-116200220 CACATGCTTTCATTTCTCTGGGG + Intronic
1075402815 10:122173188-122173210 CTGATGCTTTGGACTTTTTGGGG - Intronic
1075665261 10:124225284-124225306 CTGATGATCTCATTCCTTTGGGG - Intergenic
1075773308 10:124959630-124959652 CTTATTCTTTAAATTTTTTGTGG + Intronic
1075964236 10:126597210-126597232 CATATGCTTTCATTTCTTTTTGG - Intronic
1077072021 11:679311-679333 CTGATTTTTTTTTTTTTTTGAGG - Intronic
1077078373 11:711509-711531 CTAATTATTTTATTTTTTTGTGG + Intronic
1077748140 11:4931984-4932006 CTGCTACGTTCATTTTTCTGAGG - Intronic
1078321510 11:10339237-10339259 CTAGTTCTTTTATTTTTTTGTGG + Intronic
1078704179 11:13723197-13723219 CTGATTTTTTCTTATTTTTGTGG - Intronic
1078837182 11:15042344-15042366 CTGAAGCTTTCAATTTTAAGAGG + Intronic
1078887240 11:15514421-15514443 CTATTGATTTCATATTTTTGAGG + Intergenic
1079464804 11:20719610-20719632 CTTATGGTTTCACTTTCTTGGGG + Intronic
1079484762 11:20923779-20923801 TTGAGACTTTCATTGTTTTGAGG + Intronic
1079695787 11:23481028-23481050 TTGCTGTTTACATTTTTTTGTGG + Intergenic
1079963362 11:26950848-26950870 CAGATACTTTCACTTATTTGGGG + Intergenic
1080292683 11:30688488-30688510 TTGATTCTTTCTTATTTTTGTGG - Intergenic
1080757687 11:35217876-35217898 ATGAAGCTTTCATTTTGATGAGG + Intronic
1081123828 11:39298799-39298821 CTCATGTTTTCACTTATTTGTGG + Intergenic
1081177543 11:39947153-39947175 CTGATGCTTTCTCATCTTTGTGG - Intergenic
1082626199 11:55489492-55489514 CTGATTTTTTCATTTTTCTTTGG + Intergenic
1082907239 11:58322109-58322131 CATATGCTTTCATTTCTTTAGGG + Intergenic
1083512406 11:63223077-63223099 CTGTAGTTTTCTTTTTTTTGAGG + Intronic
1084111859 11:67019469-67019491 CTGATTTTTTTTTTTTTTTGAGG - Intronic
1084544381 11:69807356-69807378 ATCCTGCTTTCATTTCTTTGGGG + Intergenic
1085362920 11:75908405-75908427 TTCTTGCTTTCACTTTTTTGGGG + Intronic
1085650930 11:78267951-78267973 CTCATGTTTTCATATTTTTATGG + Intronic
1085656131 11:78316791-78316813 TTCCTGCTTTCAGTTTTTTGGGG - Intronic
1085830714 11:79897924-79897946 ATGATGCTTTTATTTTTGTATGG + Intergenic
1086299377 11:85409241-85409263 CTGAAGCTTTCATTTTTCTCTGG - Intronic
1086356396 11:86005537-86005559 CTAATTTTTTTATTTTTTTGTGG - Intronic
1086654542 11:89337149-89337171 CTTATGATTTCTTTTTATTGAGG - Intronic
1087082480 11:94185091-94185113 CTGATGGTTTCAGTTTTTGTAGG - Intergenic
1087095380 11:94313039-94313061 CTGATGCTTCCATTTATAAGAGG + Intergenic
1087889795 11:103525069-103525091 CTCAATCTTTCATTGTTTTGAGG + Intergenic
1088703058 11:112431667-112431689 CTGATGGTTGTATTTTTGTGGGG + Intergenic
1088880030 11:113966060-113966082 CTCATTCATTCATTTATTTGAGG + Intergenic
1089383461 11:118052538-118052560 CTGAGGCTTACATAGTTTTGAGG - Intergenic
1089900804 11:121982163-121982185 CTTATGTTTCCATTTCTTTGGGG - Intergenic
1090158353 11:124465233-124465255 CTGATGCATTCCTCATTTTGTGG - Intergenic
1090517546 11:127445346-127445368 CTGTAGCTTTCATTTGTATGAGG - Intergenic
1090957083 11:131523019-131523041 TAGATGCTTTCATGTTTCTGAGG - Intronic
1091441438 12:514013-514035 CTGAGGCTTTCATTTCTGTTGGG + Intronic
1092082601 12:5729664-5729686 CGTATGCTTTCATTTTTCTTGGG - Intronic
1092515994 12:9213310-9213332 CATATGATTTCATTTTTTGGGGG + Intergenic
1092801350 12:12170932-12170954 CTGATTCTTTCATTTATTTTAGG + Intronic
1094262341 12:28515286-28515308 CTAAAGCTTTCATTTTGTTGAGG + Intronic
1094562129 12:31565226-31565248 CTGGTTTTTTTATTTTTTTGTGG - Intronic
1094696028 12:32819738-32819760 GGGGTGCTTTCATTTTTCTGAGG - Intronic
1094697965 12:32840461-32840483 CTAATTTTTTCATTTTTTTGTGG + Intronic
1095062974 12:37724712-37724734 CTGAACCTTTCATTTGATTGAGG + Intergenic
1096174299 12:49502314-49502336 CTGATGATTTAACTTTTTGGAGG - Intronic
1096288025 12:50316974-50316996 CTAATTTTTTTATTTTTTTGTGG - Intergenic
1096310832 12:50519048-50519070 CTTCTGCGTTTATTTTTTTGGGG + Intronic
1096315877 12:50565159-50565181 CACCTGCTTTTATTTTTTTGTGG + Intronic
1096559936 12:52428869-52428891 CTGAAGCTTACAGTTTATTGGGG + Intronic
1096675196 12:53222209-53222231 CTCTTTCTTTCTTTTTTTTGTGG - Intronic
1096856064 12:54484090-54484112 CTAATTTTTTGATTTTTTTGTGG + Intergenic
1096991614 12:55808757-55808779 CTCATTCATTCATTCTTTTGAGG - Intronic
1097201233 12:57280549-57280571 CTTATGCTTACAACTTTTTGTGG - Intronic
1097204674 12:57310377-57310399 CTGATTCTTTCATTATTTCCAGG + Exonic
1097468404 12:59956589-59956611 TTGATACTTTTATTTTTTTGAGG - Intergenic
1097544693 12:60984262-60984284 CACATGATTTCATTTTTATGTGG - Intergenic
1097928196 12:65155157-65155179 CTGAGGCTTGCATTTTCTTAAGG - Intergenic
1098165961 12:67698237-67698259 CTCATGCTCTCATTTTTGTTTGG - Intergenic
1098166038 12:67699005-67699027 ATGAGGCTTTCAGTTTTCTGTGG + Intergenic
1098215420 12:68211451-68211473 GTTATACTTTCAGTTTTTTGAGG + Intronic
1099529452 12:83759330-83759352 CTTATGTTTTCATTTCTCTGGGG - Intergenic
1099645620 12:85351375-85351397 CTGATGTTTTCATTTCTCTATGG - Intergenic
1099753806 12:86813899-86813921 CTTTTTCTTTCTTTTTTTTGGGG + Intronic
1099761999 12:86935223-86935245 ATAATGCTTACATTTTGTTGAGG - Intergenic
1099834634 12:87894114-87894136 TTCAATCTTTCATTTTTTTGGGG - Intergenic
1099906699 12:88779610-88779632 CTGAAAATTTCATTCTTTTGGGG + Intergenic
1099910408 12:88825709-88825731 CTTATGCTTTCATTTCTCTCAGG - Intergenic
1100246384 12:92761945-92761967 ATAATGCCTTCATTTTTTAGAGG - Intronic
1100533391 12:95481642-95481664 TTGATACTTTCATCCTTTTGAGG - Intronic
1101310436 12:103573927-103573949 CTGATGCTTTCTTTCCTTTCTGG - Intergenic
1102223447 12:111210629-111210651 CTAATTTTTGCATTTTTTTGGGG - Intronic
1102419413 12:112792083-112792105 CTGGTGCTTTGATTTTATTTTGG + Intronic
1102424792 12:112834429-112834451 CACATACTTTCATTTCTTTGGGG + Intronic
1102557839 12:113740335-113740357 CTGATGTATTTTTTTTTTTGTGG - Intergenic
1102792176 12:115656537-115656559 CTGAAGCTTTATTTTTTTTCTGG - Intergenic
1102928545 12:116845076-116845098 CTAATTTTTTAATTTTTTTGTGG - Intronic
1103522324 12:121544610-121544632 CTGATTTTTTCTTTTTTTGGGGG - Intronic
1104392241 12:128400772-128400794 CTAATTTTTGCATTTTTTTGTGG + Intronic
1105734123 13:23249576-23249598 CTGTTGCTTTTATTTTGTTTGGG - Intronic
1105761913 13:23522869-23522891 CTCAGACTTTCCTTTTTTTGAGG - Intergenic
1105829086 13:24148468-24148490 GAGATGGTTTCATTTTTCTGAGG - Intronic
1106285382 13:28314030-28314052 CTAATTCTTGTATTTTTTTGTGG - Intronic
1106931591 13:34671522-34671544 CTGATCATTTCACTTTTTTTTGG - Intergenic
1107016711 13:35713381-35713403 CATATGTTTTCATTTATTTGGGG - Intergenic
1107839524 13:44441433-44441455 ATTATTTTTTCATTTTTTTGTGG + Intronic
1107949729 13:45451169-45451191 CTAATGTTTGTATTTTTTTGTGG + Intergenic
1108200806 13:48041101-48041123 CTCTTACTTTCATTTTTTTCAGG - Exonic
1108281103 13:48862797-48862819 CAGTTGGTTTCATTATTTTGTGG - Intergenic
1108293770 13:48990758-48990780 CTCATGTTGTCATTTTTTAGGGG - Intronic
1108411821 13:50156756-50156778 CTGATGCTTTGAAGTTTTTTGGG - Intronic
1108431573 13:50359021-50359043 TTGAGGCTCTCAATTTTTTGAGG + Intronic
1109217410 13:59605376-59605398 ATGCTGCTTTCATTCTCTTGAGG - Intergenic
1109713971 13:66196447-66196469 CTGTTGAATTCAGTTTTTTGAGG - Intergenic
1109820750 13:67650415-67650437 CTGCAGATTTCATCTTTTTGGGG + Intergenic
1109901975 13:68785404-68785426 CTGTTCCTTTAATTTTGTTGGGG + Intergenic
1109957759 13:69590843-69590865 CTGAGGCCTTGTTTTTTTTGAGG + Intergenic
1110283150 13:73719126-73719148 CTGCTGATTTGATCTTTTTGTGG + Intronic
1110321354 13:74163495-74163517 CTCATGTTTTCACTTATTTGTGG + Intergenic
1110408765 13:75180829-75180851 CTGATGCTCTCATTCTCTTTTGG - Intergenic
1110602825 13:77395608-77395630 CTAATTCTTGTATTTTTTTGTGG - Intergenic
1110701855 13:78558026-78558048 CTGATGTTTTTTTTTTTTTTTGG + Intergenic
1111020707 13:82445679-82445701 GTGGTGCTTTCATTTTTTAGTGG + Intergenic
1111235145 13:85400024-85400046 CTGATTCTTTCTCATTTTTGTGG + Intergenic
1111414240 13:87917908-87917930 CTTATTTTTGCATTTTTTTGTGG - Intergenic
1111457579 13:88505280-88505302 CTGATGGTTGCATTTTTGTGGGG + Intergenic
1111510073 13:89249796-89249818 GTAATGCTTCCATTGTTTTGAGG + Intergenic
1111852328 13:93591558-93591580 CTGATGATTTTATATTCTTGGGG + Intronic
1112527588 13:100166753-100166775 CATATGCTTTCATTTTTTTTTGG + Intronic
1112559237 13:100497264-100497286 CTTTTTCTTTCACTTTTTTGAGG + Intronic
1112770797 13:102792783-102792805 CTGACACTTTAATTTTTTTTGGG + Intronic
1112782257 13:102913988-102914010 CTGGTGCTGTCGTTTATTTGTGG + Intergenic
1113060464 13:106316824-106316846 CAGATAATTTTATTTTTTTGTGG - Intergenic
1113570315 13:111349400-111349422 CATATGCTTTCATTTGTTTTGGG + Intergenic
1114239223 14:20850727-20850749 CTCAGGACTTCATTTTTTTGCGG - Intergenic
1114910191 14:27183945-27183967 CAGATACTTTTATCTTTTTGTGG - Intergenic
1115010869 14:28543123-28543145 CTGATTCTTTCATTTGTTTAAGG + Intergenic
1115231612 14:31166684-31166706 CTAATGTTTTCATTTTTTTGTGG - Intronic
1116128907 14:40827602-40827624 CTGATGTTTTCTTCATTTTGTGG - Intergenic
1116132461 14:40874008-40874030 CTGAACCTCTCATTATTTTGAGG + Intergenic
1116189781 14:41649249-41649271 CTGGTGCTTACTTTTTTTGGGGG - Intronic
1116282957 14:42931820-42931842 CTGAGAGTTTCATTTCTTTGGGG + Intergenic
1116840381 14:49814957-49814979 TTGATGGTTTAATTTTTTTAAGG + Intronic
1117034000 14:51707992-51708014 CTCATTCTTTCATCATTTTGGGG + Intronic
1117064520 14:51997713-51997735 TTGATGTATTGATTTTTTTGGGG + Intronic
1117169545 14:53079171-53079193 ATGATGCTTTCATTGGTTTTTGG + Intronic
1117472454 14:56059751-56059773 CTGGTGCTCTCACATTTTTGTGG + Intergenic
1117621670 14:57593560-57593582 CTGGTGTTTTCATTCTTTTCAGG + Intronic
1117772059 14:59143340-59143362 CCAATGCTGTCATTCTTTTGGGG - Intergenic
1118277930 14:64402644-64402666 CTCATTTTTTAATTTTTTTGTGG - Intronic
1118297071 14:64580133-64580155 CTAATTCTTTAATTTTTTTCTGG - Intronic
1118307625 14:64668361-64668383 CAGTTACTTCCATTTTTTTGAGG + Intergenic
1118804237 14:69221030-69221052 CTAATCTTTTAATTTTTTTGTGG + Intronic
1119056305 14:71424419-71424441 ATGTTGCTTTTATTTTATTGAGG + Intronic
1119550749 14:75512210-75512232 CATATGCTTTCACTTTTTGGGGG - Intergenic
1119799642 14:77431742-77431764 GTGATGATTTCATTTATTTTGGG - Intronic
1120100073 14:80434915-80434937 TTGGTGCTTTTATTTTATTGTGG - Intergenic
1120304613 14:82752780-82752802 CTTATGTTTTCTTTATTTTGGGG - Intergenic
1120952830 14:90058449-90058471 CTGATTCTATGATTTTTTAGTGG + Intergenic
1121065553 14:90960779-90960801 CTCAAGCTTACAATTTTTTGTGG - Intronic
1122163771 14:99805638-99805660 CTAATTTTTTTATTTTTTTGTGG + Intronic
1122430840 14:101641691-101641713 CATATGCTTTCATTTCTTTGGGG - Intergenic
1202829784 14_GL000009v2_random:15051-15073 ATTATGTTTTCCTTTTTTTGAGG + Intergenic
1202933865 14_KI270725v1_random:65476-65498 CTGATGGTAACATTTTTTTCAGG - Intergenic
1125959222 15:43815179-43815201 CTGAAGTTTTTTTTTTTTTGAGG + Intronic
1126155534 15:45562396-45562418 TTTTTGCTTTCACTTTTTTGGGG - Intergenic
1126308800 15:47292241-47292263 GTGATACTTTCATTTTTGAGAGG + Intronic
1126391689 15:48162767-48162789 TTGATGTTTTAATTGTTTTGGGG + Intronic
1126655805 15:50976094-50976116 CTGTAGTTTTCTTTTTTTTGTGG - Intronic
1127188838 15:56507826-56507848 CTGATGCTTTCTCATCTTTGTGG - Intergenic
1127830279 15:62744186-62744208 CTGAGGCTTTCATTTTCTTCCGG + Intronic
1128009337 15:64277298-64277320 CTAATTATTTAATTTTTTTGTGG - Intronic
1129509157 15:76107906-76107928 CTGAAGCTTTCTTTGCTTTGGGG + Intronic
1130128984 15:81120419-81120441 CTGATGCTGACATTTTATTTTGG - Intronic
1130172774 15:81533151-81533173 CTAATTTTTTAATTTTTTTGTGG + Intergenic
1130578220 15:85112279-85112301 CATACACTTTCATTTTTTTGTGG + Intronic
1130702825 15:86202618-86202640 CAGAAGCTTTCATTATGTTGGGG + Intronic
1130865700 15:87931685-87931707 CAGATGCTTTCATTTCCTTTAGG + Intronic
1131896596 15:97038658-97038680 TTAATCCTTTCATTTTTTTTAGG - Intergenic
1132165645 15:99586158-99586180 CATATGCTTTCATTTTTCTTGGG + Intronic
1133773436 16:8880915-8880937 CAGATCCTTTTTTTTTTTTGAGG - Intergenic
1134243917 16:12525706-12525728 ATGATTTTTTCTTTTTTTTGGGG - Intronic
1134364711 16:13566492-13566514 CTGAAGATTTCATTTATTTGAGG + Intergenic
1134444183 16:14318491-14318513 CAGATGCTTTCATTTCTCTTAGG + Intergenic
1134477155 16:14584496-14584518 TAGATGCTGTCTTTTTTTTGGGG - Intronic
1134508940 16:14830813-14830835 CTGATTTTTAAATTTTTTTGTGG + Intronic
1137600271 16:49751769-49751791 CTGATCCCATCATTATTTTGGGG - Intronic
1138007684 16:53353545-53353567 CTGTTGTTTTTGTTTTTTTGGGG + Intergenic
1139012776 16:62653374-62653396 CATATGCTTTCATTTTTCTTGGG + Intergenic
1139332665 16:66205593-66205615 CAGATGGTTACATTTTTGTGAGG + Intergenic
1139406558 16:66723618-66723640 CACATGCTATCAGTTTTTTGGGG - Exonic
1139481819 16:67234922-67234944 CTGATTTTTTAATTTTTTTGAGG + Intronic
1139971605 16:70779755-70779777 CTGATGCTTTCATATTTCTTGGG - Intronic
1140009416 16:71115795-71115817 ATGATTCTTTCATGTTTTTCAGG - Exonic
1140492532 16:75350615-75350637 CTTATGCTTATATGTTTTTGTGG - Intronic
1141853221 16:86662218-86662240 CTGATGCTTTTCTTTTTCAGAGG + Intergenic
1141926864 16:87175526-87175548 TTTATGTTTTTATTTTTTTGAGG + Intronic
1142333739 16:89473176-89473198 ATGATCCTTTTTTTTTTTTGAGG - Intronic
1143386287 17:6532790-6532812 CAAATGCTTTCTTTTTCTTGGGG + Intronic
1143468459 17:7155206-7155228 CTTATGCTGTCATTTTTGTCAGG - Intergenic
1143939030 17:10519194-10519216 CTGCTTCTCTCATTTTTTTTTGG + Intergenic
1144090864 17:11855038-11855060 CTGATCCTTTCAATTATTTCAGG - Intronic
1144258017 17:13489068-13489090 GTGATGCTTTCATTATTTAATGG - Intergenic
1144666911 17:17108119-17108141 CTGAGGGTTTCGTTTTCTTGTGG + Intronic
1145021136 17:19432009-19432031 CTGATCCTTTCAATTATTTCAGG - Intergenic
1146213111 17:30957257-30957279 CTGGTGCTTTCTTTTCTCTGTGG + Intronic
1146247340 17:31300338-31300360 CATATGCTTACATTTTTTTTAGG - Intronic
1146420046 17:32676042-32676064 CTGATGTTTTCTCTTTTTTTTGG + Intronic
1146455066 17:33003380-33003402 CTAATACTTTGATATTTTTGTGG + Intergenic
1148096032 17:45052859-45052881 TAGATGCTTTATTTTTTTTGAGG - Intronic
1148585569 17:48777049-48777071 CTGTTCCTTTGATTTTTTAGGGG - Intronic
1149032948 17:52104366-52104388 CTAATTCTTGCATTTATTTGTGG + Intronic
1149053983 17:52340473-52340495 CACATGCTCTCATTTATTTGTGG - Intergenic
1149075157 17:52587910-52587932 CAGATGATTTCAATTTTTTATGG + Intergenic
1149099078 17:52883055-52883077 TTGATCTTTTCATTTTTTTCAGG - Intronic
1149281679 17:55111873-55111895 CTCACGCTTTCATTTTATTCAGG + Intronic
1149905703 17:60525216-60525238 TTAAAGCTTTGATTTTTTTGTGG - Intronic
1150012897 17:61523014-61523036 TTTATCCTTTTATTTTTTTGAGG + Intergenic
1150040060 17:61850828-61850850 CTCAAGCTTTCTTTTTTTTTTGG - Intronic
1151086246 17:71384487-71384509 CAGATACTATCATTTTCTTGGGG - Intergenic
1151128958 17:71875978-71876000 CTGTTGTTTTCCTTCTTTTGGGG - Intergenic
1151841367 17:76620396-76620418 CTGTTGATTTCATTATTTTTTGG + Intergenic
1153125694 18:1787690-1787712 TTGATTCGTTCATTTTTTGGAGG - Intergenic
1153723750 18:7935531-7935553 CTGTTGCTTACATCTTTTTTTGG - Intronic
1153785754 18:8533496-8533518 CTGAGGTATTTATTTTTTTGTGG - Intergenic
1153871722 18:9327240-9327262 TTGATGCTGTAATTGTTTTGGGG + Intergenic
1153886287 18:9470282-9470304 ATGATGTTTTTTTTTTTTTGAGG + Intergenic
1154098532 18:11445542-11445564 TTTATGCTTTCACTTTTTTGGGG + Intergenic
1154301755 18:13200121-13200143 CTGATATTTTCATTTTTGTAGGG + Intergenic
1154318672 18:13326637-13326659 CTGAGGCTTTCACTTTTCTGCGG + Intronic
1155260235 18:24034957-24034979 CTCCTGCTTTCAGTTTTTTCGGG + Intronic
1155277623 18:24204024-24204046 CTGATGCCTTCATTTTAATGGGG + Intronic
1155288495 18:24316574-24316596 TTGATCCTTTTATTGTTTTGTGG - Intronic
1155587390 18:27382665-27382687 TTGAGCTTTTCATTTTTTTGTGG + Intergenic
1156131904 18:33986771-33986793 CTTATGTTTTCATTTATTTTGGG - Intronic
1156307373 18:35890197-35890219 CTGATGCATTTCATTTTTTGTGG + Intergenic
1156426958 18:37024156-37024178 CTGATTTTTTAAATTTTTTGTGG + Intronic
1156623222 18:38877815-38877837 CTTATGCTTTCTTTTCTTTTAGG - Intergenic
1156847315 18:41681440-41681462 CTGAAGATTTCATTTATCTGGGG - Intergenic
1156923889 18:42554967-42554989 CTGCTGCTTTAATACTTTTGGGG - Intergenic
1157985895 18:52436916-52436938 TTTTTGTTTTCATTTTTTTGAGG - Intronic
1158043718 18:53129824-53129846 CTTATGTTTTCATTTCTTTTGGG + Intronic
1158135920 18:54208160-54208182 TTTGTGTTTTCATTTTTTTGTGG - Intronic
1158574431 18:58624239-58624261 CACATGCTTTCCTTTTTCTGTGG - Intronic
1159273549 18:66186631-66186653 GTGATGTTTTCATATTTTGGGGG - Intergenic
1159575147 18:70166934-70166956 CTGATGATTTCCTTTATTAGCGG + Exonic
1159782928 18:72680054-72680076 CTAATACTTTTTTTTTTTTGAGG - Intergenic
1159801181 18:72901309-72901331 ATGCTGCTTTCATTCTCTTGGGG - Intergenic
1160084332 18:75760849-75760871 GTGGTGATTTCATTTTTTTGGGG + Intergenic
1160595231 18:79968832-79968854 CTGATCCTAGCATTCTTTTGTGG - Intronic
1160755378 19:754459-754481 CTAATTTTTTCTTTTTTTTGAGG - Intronic
1161611461 19:5245452-5245474 CTAAATGTTTCATTTTTTTGTGG + Intronic
1162689286 19:12415342-12415364 ATGATGCTTTTTCTTTTTTGAGG - Intronic
1162863036 19:13522477-13522499 CCCCTGCTTTCATTTCTTTGAGG + Intronic
1163014529 19:14446170-14446192 CTAATTTTTGCATTTTTTTGTGG + Intronic
1163101867 19:15102335-15102357 CTGATTTTTCTATTTTTTTGTGG - Intergenic
1163859630 19:19735049-19735071 TTGCTGCTTTCAGTTTTTTAGGG + Intergenic
1163925241 19:20335051-20335073 CTGATGCTTTTATTTTTGTGGGG + Intergenic
1164602850 19:29575261-29575283 TTGAAGCTTACATTTTTTGGGGG - Intergenic
1164877767 19:31704435-31704457 CTAATTCTTTGATTGTTTTGAGG - Intergenic
1165048264 19:33123584-33123606 CTAATTTTTTAATTTTTTTGTGG - Intronic
1165712423 19:38021538-38021560 CTGATCCTTTTTTTTTTTTTTGG + Intronic
1165714420 19:38035240-38035262 CTGAATCTTTCATTTTACTGAGG - Intronic
1165837286 19:38766745-38766767 CTGATGTTTTGATTTCTTTTGGG - Intronic
1166019181 19:40010007-40010029 CTTATGCTTTCATTTATCTTGGG + Intronic
1166036913 19:40175170-40175192 CTGATTTTTTTATTTTCTTGTGG + Intergenic
1166227857 19:41408119-41408141 CTAATGTTTGTATTTTTTTGTGG + Intronic
1166449562 19:42886778-42886800 CATATGTTTTCATTTTTTGGGGG + Intronic
1166460862 19:42987074-42987096 CATATGTTTTCATTTTTTGGGGG + Intronic
1166478154 19:43147061-43147083 CATATGTTTTCATTTTTTGGGGG + Intronic
1167195682 19:48026448-48026470 CTGATTTTTGTATTTTTTTGTGG - Intergenic
1167988279 19:53336526-53336548 CTTTTGCTTTCATTTTTTGGTGG - Intronic
1168331128 19:55569648-55569670 CATATGTTTTCATTTCTTTGGGG - Intergenic
1202642903 1_KI270706v1_random:112734-112756 ATTATGTTTTCCTTTTTTTGAGG - Intergenic
925229282 2:2218220-2218242 CATATGCTCTCATTTCTTTGGGG - Intronic
926433287 2:12812718-12812740 CATATGCTTTCATTTTTCTTGGG - Intergenic
926539303 2:14155041-14155063 CTATTGCTTTTATTTCTTTGGGG - Intergenic
927064505 2:19457702-19457724 CTGATGTTTTTTTTTTTTTGAGG + Intergenic
927112679 2:19875214-19875236 CTGATCCTTTCAATTATTTCAGG - Intergenic
927140504 2:20127096-20127118 TTCATGTTTTCATTATTTTGAGG + Intergenic
928013749 2:27635111-27635133 CCAAGGCTTTGATTTTTTTGTGG + Intronic
928453849 2:31401757-31401779 CTATTGCTTTCATTTCTCTGTGG + Intronic
928565635 2:32545406-32545428 CATATGTTTCCATTTTTTTGAGG + Intronic
928689606 2:33785833-33785855 CTGATGCTTTCAGGTTCTGGAGG - Intergenic
928815353 2:35288142-35288164 GTAATGCTTTTATTATTTTGAGG + Intergenic
928961125 2:36927341-36927363 CTGATTTTTTAAATTTTTTGTGG - Intronic
929660437 2:43779091-43779113 CTAATTGTTTTATTTTTTTGGGG - Intronic
929866516 2:45721709-45721731 CTAATTTTTTAATTTTTTTGTGG - Intronic
930118712 2:47742170-47742192 CTGGTGGTTTCATTTTGTTGGGG + Intronic
930431039 2:51276778-51276800 CTGATCCTTTTTTTTTTTTTTGG - Intergenic
930472591 2:51838137-51838159 CTTATGTATTCATTTTTTAGGGG - Intergenic
930509408 2:52326137-52326159 CTAATTTTTTTATTTTTTTGAGG - Intergenic
930670820 2:54148341-54148363 TTGATGCTATCATTTTAATGGGG + Intronic
930951676 2:57150206-57150228 CTGATGATTTTATTTCTGTGGGG - Intergenic
931036427 2:58249034-58249056 CTAATTCTTGTATTTTTTTGTGG + Intergenic
931097773 2:58961511-58961533 CTTTTGCTTTCTTGTTTTTGGGG - Intergenic
931196815 2:60059608-60059630 CTGATACTTTGATATTGTTGTGG + Intergenic
931459180 2:62435381-62435403 ATGATGTTTAAATTTTTTTGTGG + Intergenic
931582257 2:63789672-63789694 CTTATGCTTTCATTTTTGAAAGG + Intronic
931604425 2:64038165-64038187 CATATGCTTTCATTTTTCTTTGG + Intergenic
932263111 2:70343459-70343481 CTGCTGTTATTATTTTTTTGAGG + Intergenic
932597968 2:73106057-73106079 CTTTTTCTTTCTTTTTTTTGAGG - Intronic
933465847 2:82650092-82650114 TTGCTGCTTTTTTTTTTTTGTGG - Intergenic
934045625 2:88170643-88170665 CTGATGCTTTGCGTTTTCTGCGG + Intronic
934464207 2:94244492-94244514 CTGATGGTAACATTTTTTTCAGG - Intergenic
934651903 2:96097484-96097506 CAGAAGCTTTCATTTCTTTTGGG - Intergenic
936316296 2:111427382-111427404 CTGTGACTTTCATCTTTTTGAGG + Intergenic
936891527 2:117376160-117376182 CATATGCTTTCATTTCTTTAGGG + Intergenic
937569266 2:123335359-123335381 CTGATTCTTTCTTATCTTTGTGG - Intergenic
938399807 2:130981073-130981095 TTTATTATTTCATTTTTTTGTGG + Intronic
938748523 2:134305215-134305237 CTGAGGTTTTCATTTTGTTTTGG - Intronic
939027546 2:137032003-137032025 CTGATTTTTGTATTTTTTTGTGG + Intronic
939028439 2:137042164-137042186 CTGATGTGTTCATTGTTTTGTGG + Intronic
939179857 2:138791673-138791695 CTGATGATTGCATTTCTGTGGGG + Intergenic
939417740 2:141923190-141923212 CTGCTATTTTCATTGTTTTGTGG - Intronic
939463580 2:142528630-142528652 GTGATGATTTCATTTTTTTATGG + Intergenic
940202948 2:151171536-151171558 CTGATTTTATCATTTTTTTCTGG - Intergenic
940532156 2:154891708-154891730 CTCAAGGTTTCATTTATTTGGGG + Intergenic
940799229 2:158115121-158115143 CAAATGCTTTCATTCTGTTGGGG - Exonic
941182584 2:162278107-162278129 CTTTTGCTTTCCATTTTTTGGGG + Intronic
941195578 2:162447267-162447289 CTTTAGCTTTCATTTTTTTCAGG - Intronic
941522873 2:166570288-166570310 TGTATGCTTTCATTTGTTTGGGG - Intergenic
941669321 2:168274403-168274425 CATATGCTTTCATTTTTCTTAGG + Intergenic
942757013 2:179353153-179353175 TTCATGCTTTCAAGTTTTTGGGG + Intergenic
942875859 2:180796833-180796855 CACATGCTTTCATTTCTTTGGGG - Intergenic
943118166 2:183699939-183699961 CTGAAGCTTTCATTCTAATGAGG + Intergenic
943138470 2:183946775-183946797 CTGATGCTTGTATTATTTTTTGG - Intergenic
943439526 2:187910053-187910075 CAGATGCTTTCATTTTTATAAGG + Intergenic
944623857 2:201549018-201549040 CTGATGTTTTCATTTGGCTGGGG - Intronic
944777933 2:202988277-202988299 CTTATGCTTTCATTTCTCTTGGG + Intronic
944883218 2:204036599-204036621 CTGAAACTTTCATCTGTTTGTGG - Intergenic
944941413 2:204632406-204632428 CTGATTCTTTCTTATCTTTGTGG + Intronic
945233718 2:207615305-207615327 CTAATTTTTTTATTTTTTTGTGG - Intronic
945775729 2:214104029-214104051 CCGATGCTTTCCTTCTTTTTGGG - Intronic
945973001 2:216248424-216248446 CTCATGTTCTCATTTATTTGTGG - Intergenic
946192095 2:218012932-218012954 CTGATGCTTTGAGTGTTTTGAGG - Intergenic
946293791 2:218766630-218766652 CCTCTGCTTTCTTTTTTTTGGGG + Intergenic
946796836 2:223363385-223363407 CTCATGCTCTCACTTATTTGTGG + Intergenic
946915432 2:224515856-224515878 CTAATCTTTTTATTTTTTTGTGG + Intronic
946915688 2:224518456-224518478 CATATGCTTTCATTTTTCTTGGG + Intronic
947560171 2:231142208-231142230 CTTATGTTTTAATTTATTTGGGG + Intronic
1168941548 20:1716657-1716679 CTATGGCTTTTATTTTTTTGAGG - Intergenic
1169305625 20:4487992-4488014 CTGAGGCTTTCACTTTCCTGGGG - Intergenic
1169574844 20:6948236-6948258 CTGACGTTTTTATTTTTTTTTGG + Intergenic
1169781727 20:9317369-9317391 AAGATGCTCTCATTTTTGTGGGG + Intronic
1170193703 20:13669272-13669294 CTTTTTCTTTCTTTTTTTTGGGG + Intergenic
1170432713 20:16291444-16291466 CTGATGCTTACATAGTTTTCAGG - Intronic
1170686346 20:18573130-18573152 CTGATGCTTTCAAAATTCTGAGG - Intronic
1170921018 20:20679404-20679426 CTGATGCTGTCATTCATCTGAGG - Intronic
1170991784 20:21308337-21308359 CGTATGCTTGCATTTGTTTGGGG + Intronic
1171288170 20:23960396-23960418 CACCTGCCTTCATTTTTTTGTGG - Intergenic
1171890022 20:30702937-30702959 ATTATGTTTTCCTTTTTTTGAGG - Intergenic
1172091199 20:32434291-32434313 ATGATGATTTCATTGTTTTAAGG + Intronic
1172162210 20:32876462-32876484 ATAATGCTTTCATGTTTTTCTGG + Intronic
1172237425 20:33387764-33387786 CTGGTGGTTTAATTTTTTTCTGG - Intronic
1173772218 20:45670517-45670539 GTGGTGAATTCATTTTTTTGCGG - Intergenic
1174194004 20:48760108-48760130 CCAATGCTTTTTTTTTTTTGAGG - Intronic
1174579222 20:51559219-51559241 CTTATGCTTTCATTTCCCTGAGG + Intronic
1174873229 20:54202605-54202627 CTCATTCTTTCTTTTTTTTATGG + Intergenic
1175627687 20:60502521-60502543 CTGTTGATTTCATTTTCTTTGGG + Intergenic
1175960438 20:62633856-62633878 CACATACTTACATTTTTTTGTGG - Intergenic
1176362992 21:6014103-6014125 TTTCTGCTTTCAATTTTTTGGGG + Intergenic
1176598844 21:8773687-8773709 ATTATTCTTTCCTTTTTTTGAGG + Intergenic
1176608973 21:8859891-8859913 ATTATGTTTTCCTTTTTTTGAGG + Intergenic
1177161708 21:17554839-17554861 CTAATGCTTTGGTTCTTTTGTGG + Intronic
1177410166 21:20719318-20719340 CTGATGCTTCCAATTGTTTACGG - Intergenic
1177475900 21:21622226-21622248 CGCATGATTTCATTTTTATGAGG - Intergenic
1177512185 21:22102562-22102584 ATGACGATTTCATTTTTTTATGG + Intergenic
1178387147 21:32161961-32161983 CTGTTGCTATAATTATTTTGAGG - Intergenic
1178407444 21:32336210-32336232 CTTTTTCTTTCTTTTTTTTGTGG + Intronic
1178616186 21:34135233-34135255 CACATGCTTTAATTTCTTTGGGG + Intronic
1178775805 21:35549307-35549329 GTGATGATCTCATTTATTTGAGG + Intronic
1178801019 21:35795722-35795744 CTAATTTTTTAATTTTTTTGTGG + Intronic
1179008486 21:37534713-37534735 ATGATGCCTGCATTTGTTTGAGG + Intergenic
1179298000 21:40080399-40080421 CTGATGCTTGCATTTTGTGTGGG + Intronic
1179760526 21:43524442-43524464 TTTCTGCTTTCAATTTTTTGGGG - Intergenic
1180114516 21:45691022-45691044 AATATACTTTCATTTTTTTGTGG - Intronic
1180278120 22:10664787-10664809 CTGATGGTAACATTTTTTTCAGG - Intergenic
1180359063 22:11869723-11869745 ATTATGTTTTCCTTTTTTTGAGG + Intergenic
1180585369 22:16883640-16883662 CTGATGGTAACATTTTTTTCAGG - Intergenic
1180892403 22:19299191-19299213 CTGATGCTTTAAATTATTTCAGG + Intergenic
1181782349 22:25202275-25202297 CAGGTGTTTTCATTTTTTTAAGG + Intronic
1181903877 22:26177868-26177890 CTGATATTTTCATTTTATTGAGG + Intronic
1182252713 22:29014233-29014255 CTGATGGTTTTATTGCTTTGGGG + Intronic
1183110297 22:35643836-35643858 CTAATTTTTGCATTTTTTTGTGG + Intergenic
1183855841 22:40634250-40634272 CTAATTCTTTAACTTTTTTGTGG + Intronic
1183885722 22:40880136-40880158 CTGGTGCTTTAATTATTATGGGG - Intronic
1183908508 22:41061221-41061243 CTTTTTCTTTCTTTTTTTTGGGG + Intergenic
1184154614 22:42659049-42659071 CATATGTTTTCATTTCTTTGGGG + Intergenic
949177902 3:1088980-1089002 CATATGCTTTCATTTCTTTTGGG + Intergenic
949241084 3:1872646-1872668 CTAATTCTTTCTTTTTTATGTGG - Intergenic
949332005 3:2933122-2933144 CAGATGGTTACATTTTTATGAGG + Intronic
949501490 3:4684296-4684318 CTGGTGCTTTCATGCTTTTGTGG - Exonic
950050017 3:9981037-9981059 CTAATGTTTAAATTTTTTTGTGG - Intronic
950286648 3:11750472-11750494 CTAATTTTTACATTTTTTTGTGG + Intergenic
950859208 3:16132642-16132664 CTGATTCTTTTTTTTTTTGGAGG - Intergenic
951005081 3:17606275-17606297 CTAATTTTTTAATTTTTTTGTGG - Intronic
951048711 3:18070102-18070124 CTGAAGCATTAATTTTTTTCTGG + Intronic
951049304 3:18076728-18076750 TTGATACTTTCATTTTTATGAGG + Intronic
951086898 3:18522121-18522143 CAGATACTTTAATTTTCTTGGGG + Intergenic
951164617 3:19469988-19470010 ATCAAGCTTTCATTTTTCTGAGG - Intronic
951402512 3:22251028-22251050 ATGATGTTTTTATTTTTCTGAGG - Intronic
951607413 3:24451628-24451650 CTGCTGCTTTCCTTTTGGTGAGG + Intronic
951622666 3:24622885-24622907 GTTTTTCTTTCATTTTTTTGGGG + Intergenic
951711707 3:25590396-25590418 CTCATGCATTCATTTCTTGGCGG + Intronic
951724328 3:25739882-25739904 CTTATGTTTTCATATTTTTCAGG - Intronic
952212796 3:31246304-31246326 CTGATGCTACAATTTTTTAGGGG - Intergenic
952318992 3:32258673-32258695 CTGATTTTTTTAATTTTTTGTGG + Intronic
952486850 3:33820883-33820905 ACTCTGCTTTCATTTTTTTGGGG + Intronic
952985675 3:38779291-38779313 CTGCTGCTGGGATTTTTTTGGGG + Intronic
953121478 3:40046820-40046842 CTGATACTTCCTTTTATTTGTGG - Intronic
953165537 3:40461532-40461554 CTGGTCCTTTCTTTTTTTGGAGG + Intronic
954442505 3:50529587-50529609 CTGATGCTCTATTTTTTTGGGGG + Intergenic
954501166 3:51017189-51017211 ATGATCCTTTGATTTTTCTGTGG + Intronic
955114721 3:55986275-55986297 CTGATGCTGTCATTGTACTGTGG - Intronic
955359593 3:58261647-58261669 CTGGTTCTTTCTTTTTATTGTGG + Intronic
955486883 3:59443805-59443827 CTTATGCTCTCACTTTTTTGTGG + Intergenic
955707295 3:61741442-61741464 CTGATGTTTTCAATTTTATATGG + Intronic
955852387 3:63234471-63234493 ATGCTGCCTTCATTGTTTTGGGG + Intronic
955909142 3:63842408-63842430 CTCATATTTTCAGTTTTTTGAGG - Intronic
955914133 3:63889537-63889559 CTGAAGATTTGATTTTTCTGAGG - Intronic
956506229 3:69943232-69943254 TGGATGCCTTGATTTTTTTGTGG - Intronic
958028083 3:88072750-88072772 CTGATGCTTTCATTTTTTTGTGG - Intronic
958047649 3:88304411-88304433 CTGATGCATACATTTTTATAGGG + Intergenic
958267206 3:91452467-91452489 CTTATGCTCTCATTTTTATATGG - Intergenic
958481562 3:94651482-94651504 CAGATGCATTGATTTTTTGGAGG + Intergenic
958500439 3:94899937-94899959 CTTATTCTTTCATTTTTTTCTGG - Intergenic
958617751 3:96517114-96517136 CTGTTGCTTTTTGTTTTTTGTGG - Intergenic
958643833 3:96842770-96842792 CTGCTGATTTTATTTTTCTGGGG - Intronic
959229863 3:103633883-103633905 CTGTAGTTTTCTTTTTTTTGTGG + Intergenic
959404824 3:105948356-105948378 CATATGCTTTCATTTCTTTTTGG + Intergenic
959410211 3:106011519-106011541 CATATGCTTTCATTTCTTTCTGG - Intergenic
959426544 3:106196767-106196789 CACATGGTTTCATTTATTTGTGG - Intergenic
959918262 3:111843085-111843107 CATATGTTTTCATTTCTTTGGGG + Intronic
960172445 3:114477979-114478001 CTCTTTCTTTCTTTTTTTTGAGG + Intronic
960324789 3:116282765-116282787 ATGAGCCTCTCATTTTTTTGGGG - Intronic
960422453 3:117463837-117463859 CTCATGCTTTCCTATTTTAGAGG - Intergenic
960462571 3:117954518-117954540 CTAATGCTTCTATTTTTTTGTGG - Intergenic
961581538 3:127887380-127887402 CTGCTGTTCTCATTTTTTGGGGG + Intergenic
961801096 3:129450249-129450271 CTGTTGCTTGAATTTTTCTGGGG - Intronic
962114559 3:132489450-132489472 CATATGCTTTCATTTTACTGTGG + Intronic
962782322 3:138731248-138731270 CTTTTCCTTTCTTTTTTTTGGGG + Intronic
963115422 3:141724758-141724780 CTGAAGCTTTCTTTCTTTTTTGG - Intergenic
963179934 3:142343999-142344021 CACATGTTTTCATTTATTTGTGG + Intronic
963633648 3:147766095-147766117 ATGATAATTTCATTTTCTTGTGG - Intergenic
963658922 3:148099177-148099199 CTGATGTTCTCATTTATTTGTGG + Intergenic
963735451 3:149013709-149013731 CTGAAGGTTTAATTTCTTTGGGG - Intronic
963773310 3:149411896-149411918 CTCATGTTTTCATTTCCTTGAGG - Intergenic
964312229 3:155406219-155406241 CTGATCCTTTCAGTTATTTCAGG + Intronic
964323504 3:155522943-155522965 ATGATGCTTTTCTTTTTTTGCGG + Intronic
964348218 3:155776618-155776640 CTGATTTTTACATTTTTTTGTGG - Intronic
964935319 3:162077374-162077396 CGTAAGCTTTCATTTTTCTGGGG + Intergenic
965026593 3:163310061-163310083 ATGATGATTTCCTTTCTTTGGGG - Intergenic
965043762 3:163548096-163548118 GTGATGATTTTATTATTTTGTGG - Intergenic
965343810 3:167522484-167522506 CAGATGTTTTCGTTTTTTTCAGG - Exonic
965422927 3:168484774-168484796 TTGATTCTTTCTTTTTTATGTGG - Intergenic
965549478 3:169949643-169949665 CTAATTTTTTCATTTTTTTGTGG + Intergenic
966229123 3:177631562-177631584 TTGTTGCTTTTTTTTTTTTGAGG + Intergenic
966566519 3:181388302-181388324 CTGCTGCTCTCATTTATATGTGG - Intergenic
967435731 3:189443918-189443940 CTGTGGCTTTCTTTTCTTTGTGG - Intergenic
967533659 3:190577694-190577716 CTAATTTTTTAATTTTTTTGTGG + Intronic
967588064 3:191238369-191238391 CAGATGCTTCCATTCTTGTGAGG + Intronic
967659657 3:192091090-192091112 CTGATTCTTTCTTTTCTGTGTGG - Intergenic
967836573 3:193969476-193969498 CTAATGCTTTTCTTTATTTGAGG - Intergenic
968109601 3:196033643-196033665 CTAATTTTTTAATTTTTTTGTGG - Intronic
968485839 4:861025-861047 CTGCTGCTCTAATTGTTTTGGGG + Intronic
968970900 4:3793229-3793251 CTGATTATTTTTTTTTTTTGCGG + Intergenic
969201742 4:5612327-5612349 CTGATTCTTTCAATTATTTCAGG + Intronic
969295076 4:6265133-6265155 CTGATTTTTAAATTTTTTTGTGG + Intergenic
970394287 4:15650198-15650220 CAGATGATTTCTTTTTTATGGGG - Intronic
970412394 4:15821379-15821401 CTCCTGCATTCATTTTTTTTTGG - Intronic
971107472 4:23542411-23542433 CTGATTCTTTCTTATCTTTGTGG - Intergenic
971313831 4:25550276-25550298 CTGGAGCTAACATTTTTTTGGGG + Intergenic
971537819 4:27776312-27776334 CTGCAGCTTTCAGATTTTTGAGG + Intergenic
972037783 4:34548212-34548234 ATGTTGCTTTTTTTTTTTTGAGG - Intergenic
972767526 4:42165649-42165671 TTGATGGTTTTTTTTTTTTGAGG + Intergenic
973087834 4:46089960-46089982 CCTATGTTTTTATTTTTTTGAGG - Intronic
973122143 4:46534697-46534719 TTGATGCCTTCCTTCTTTTGTGG - Intergenic
973138400 4:46734950-46734972 CTGATGTTTCCACTCTTTTGGGG + Exonic
973252266 4:48072924-48072946 TTTATGTTTTAATTTTTTTGAGG + Intronic
974419224 4:61650617-61650639 CTTTTCCTTTCTTTTTTTTGAGG + Intronic
974830803 4:67187088-67187110 CTAATTTTTTCTTTTTTTTGAGG + Intergenic
974985786 4:69025055-69025077 CTGATTCTCTCTTATTTTTGTGG + Intronic
975079993 4:70265641-70265663 CTCAATTTTTCATTTTTTTGAGG - Intergenic
975148522 4:70995420-70995442 CTAATTTTTTAATTTTTTTGTGG - Intronic
975560044 4:75700837-75700859 CTAATAATTTTATTTTTTTGAGG + Intronic
975939338 4:79623206-79623228 CTGATGCCTTCCTTGTTTTCAGG + Intergenic
975998589 4:80344331-80344353 CTGATGGTTGTATTTTTGTGGGG - Intronic
976268428 4:83206695-83206717 CTGATGCTCACCTTTTTCTGTGG + Intergenic
976550532 4:86389768-86389790 ATGATGCTTTATTTTCTTTGTGG + Intronic
976595252 4:86889749-86889771 CTAATTTTTTGATTTTTTTGTGG - Intronic
976599155 4:86922282-86922304 CTTTTCCTTTCATTGTTTTGGGG - Intronic
976792813 4:88898472-88898494 CTTATGCTTTGATTTTTTTCTGG - Intronic
977117536 4:93049516-93049538 TTAATGCATTAATTTTTTTGGGG - Intronic
977135085 4:93294204-93294226 CTCATCTTTTCGTTTTTTTGTGG - Intronic
977389427 4:96388847-96388869 CTCATGCTTTCACTCTTTTATGG + Intergenic
977979179 4:103302876-103302898 CCTATGGTTTCATTATTTTGTGG + Intergenic
978354510 4:107857345-107857367 CTGGTGTTTTCATTTTTTTGGGG + Intronic
978380034 4:108117437-108117459 GTTATGCTTTCATTTTCTTTTGG - Intronic
978539771 4:109804273-109804295 CTGATTCTTTCACTCTTTGGAGG - Intergenic
979026300 4:115581626-115581648 ATAATTTTTTCATTTTTTTGTGG - Intergenic
979116476 4:116830290-116830312 CTGATCCTTTCTAATTTTTGTGG - Intergenic
979594356 4:122517669-122517691 TTAAATCTTTCATTTTTTTGAGG - Intergenic
979774662 4:124574549-124574571 TTGCTGCTTTCATTGCTTTGGGG + Intergenic
979986081 4:127317346-127317368 CTGTTGATTTTATTTTATTGTGG - Intergenic
980099128 4:128523753-128523775 CTGATTCTATCATGTTTGTGTGG - Intergenic
980146522 4:128992241-128992263 CTGATTCTTTTTTTTTCTTGTGG - Intronic
980427310 4:132643086-132643108 TTTATGCTTTCTTTTTTGTGGGG + Intergenic
980556730 4:134416608-134416630 CTGTTGCTTTTTTTTTTTTTTGG - Intergenic
980645224 4:135635380-135635402 CTGATTCTTTCTCATTTTTGTGG + Intergenic
981138124 4:141236341-141236363 CGGATGCTTTATTTTTATTGGGG - Intergenic
981463307 4:145036095-145036117 CTAATGCTTAAATTTTTTTTAGG - Intronic
981499233 4:145430878-145430900 CATATGCTTTCATTTCTTTTGGG + Intergenic
981863723 4:149388169-149388191 CTTATGTTTTCATTTTTCTTGGG + Intergenic
981956212 4:150477464-150477486 CTGATGGTTTAATTTTTTCTTGG - Intronic
982355155 4:154458902-154458924 ATGATGTTTTCATTGTTTTTTGG - Intronic
983118897 4:163855746-163855768 CTGATGGTGTCATAATTTTGTGG - Intronic
983180128 4:164638183-164638205 CTGATGCTGACAATTTTATGTGG + Intergenic
983259706 4:165442524-165442546 CTGATGTTTTGATGTTTATGGGG - Intronic
984063166 4:175017230-175017252 CTGCTGCTATCATAGTTTTGTGG + Intergenic
984067025 4:175061732-175061754 TGCATACTTTCATTTTTTTGAGG - Intergenic
984354694 4:178642931-178642953 CATATGTTTTCATTTCTTTGAGG - Intergenic
984901291 4:184589040-184589062 CTGATGCCTTCATATCCTTGGGG + Intergenic
985117028 4:186602355-186602377 CTGATGCGTTCATTTCTATACGG - Intronic
1202770271 4_GL000008v2_random:198629-198651 ATTATGTTTTCCTTTTTTTGAGG - Intergenic
985989995 5:3549023-3549045 CTGATGATTGTATTTCTTTGGGG - Intergenic
986744684 5:10733326-10733348 CTGCTGCTTTCAATTCTTTTGGG + Intronic
986877947 5:12133233-12133255 CTGATTCTTTCTTATTTGTGTGG - Intergenic
986951708 5:13095480-13095502 CTGATGCTTTCTGTTTTGTAAGG - Intergenic
987038989 5:14044390-14044412 CTAATTTTTACATTTTTTTGTGG - Intergenic
987295770 5:16549838-16549860 TTGATGTTTTCCTTATTTTGGGG - Intronic
987592417 5:19947318-19947340 TTGAGCCTTTGATTTTTTTGTGG - Intronic
987743127 5:21935820-21935842 CGGATGCTCTCACTTATTTGTGG - Intronic
987887799 5:23832841-23832863 CTGATTCTTTCTTATCTTTGTGG - Intergenic
987914436 5:24192914-24192936 CTCATTCATTTATTTTTTTGTGG - Intergenic
988118956 5:26934763-26934785 CTGGTGCTTTCACTTTTTTAAGG - Intronic
988920407 5:35936120-35936142 CTGGTGGTTCCATTTTTTTCTGG - Intronic
989073641 5:37539049-37539071 CAGATGCTTTCATTATTTGAAGG + Intronic
989095228 5:37775725-37775747 TTGATGGGTTCATATTTTTGTGG + Intergenic
989481577 5:41936537-41936559 CTCAATCTCTCATTTTTTTGTGG - Intronic
990066377 5:51720559-51720581 CTTTTGCTTTCATATTTTTCAGG - Intergenic
991076754 5:62548316-62548338 CTGTTACTTTAATTTTCTTGAGG + Intronic
991641916 5:68762870-68762892 CTGAGGAGTTCATTTTTCTGTGG - Intergenic
991749790 5:69788711-69788733 CGGATGCTCTCACTTATTTGTGG + Intergenic
991763322 5:69945931-69945953 CGGATGCTCTCACTTATTTGTGG - Intergenic
991784004 5:70172200-70172222 CGGATGCTCTCACTTATTTGTGG + Intergenic
991801367 5:70368525-70368547 CGGATGCTCTCACTTATTTGTGG + Intergenic
991827230 5:70641517-70641539 CGGATGCTCTCACTTATTTGTGG - Intergenic
991842549 5:70820989-70821011 CGGATGCTCTCACTTATTTGTGG - Intergenic
991876451 5:71172575-71172597 CGGATGCTCTCACTTATTTGTGG + Intergenic
992182244 5:74209894-74209916 TTCATGCATTCATTTTTGTGTGG - Intergenic
992192910 5:74311708-74311730 CAGATGCTTGCATTTTTATCTGG - Intergenic
992371720 5:76150801-76150823 CTAATTTTTTTATTTTTTTGTGG + Intronic
992493044 5:77264252-77264274 CAGATGTTTTCATTTCTTTCAGG + Intronic
992510829 5:77433222-77433244 CTGATCATCTCATTATTTTGTGG - Exonic
993021146 5:82592509-82592531 ATTATTCTTTCTTTTTTTTGGGG + Intergenic
993205990 5:84878818-84878840 CTCATGTTCTCATTTATTTGTGG + Intergenic
993287134 5:86014043-86014065 CTCATGTTTTCACTTATTTGTGG - Intergenic
993380518 5:87201646-87201668 CTGAAATTTTCTTTTTTTTGTGG + Intergenic
993654027 5:90556256-90556278 ATGCAGCTTTCATTTTTATGGGG + Intronic
993876509 5:93313759-93313781 CACATGCTTTCATTTCTTTTGGG - Intergenic
993971018 5:94419964-94419986 ATGATGCTTTAAATTTTTTCAGG + Intronic
994088067 5:95781872-95781894 CAAATGCTTTCATTTTTATTAGG - Intronic
994365893 5:98916617-98916639 CTGGTAACTTCATTTTTTTGTGG - Intronic
994949515 5:106441109-106441131 CTGATTTTTACATTTTTTTCAGG + Intergenic
995212363 5:109554592-109554614 CTGAAACTTTCATCTTTTTCTGG + Intergenic
995685734 5:114770207-114770229 TTGATGCATGCATTTGTTTGTGG + Intergenic
995752259 5:115464988-115465010 CTCATCCTTTCGTTTTTTTCTGG - Intergenic
995926561 5:117381969-117381991 CTGATGTTTTCATTCTTTCACGG - Intergenic
996541679 5:124636391-124636413 ATGGAGCTTTCATTTTTTGGTGG - Intergenic
996766761 5:127042079-127042101 CTCATGCCTCCAGTTTTTTGTGG + Intergenic
996778513 5:127159215-127159237 CTGATTCTTTCTTATCTTTGTGG + Intergenic
997212287 5:132084230-132084252 CTAATTGTTTTATTTTTTTGTGG - Intergenic
997482942 5:134202715-134202737 CATATGCTTTCATTTCTTTTAGG + Intronic
999217625 5:149948527-149948549 CTAATGTTTTCATTCTTTTTCGG + Intergenic
999566050 5:152863039-152863061 CTGAAGATTTTTTTTTTTTGGGG - Intergenic
999847674 5:155502854-155502876 TTTTTGTTTTCATTTTTTTGAGG - Intergenic
999852337 5:155555648-155555670 CTGGTAGTTTGATTTTTTTGTGG + Intergenic
1000006648 5:157191234-157191256 CTTATGTTTTAACTTTTTTGTGG + Intronic
1000369303 5:160519589-160519611 CTAATGCTTTCAGTTTCTTATGG + Intergenic
1001606858 5:172966856-172966878 CTGGTGGTTTTTTTTTTTTGAGG + Intronic
1001619164 5:173067996-173068018 CTGAAGATTTTTTTTTTTTGAGG - Intronic
1001869938 5:175144028-175144050 TTGACCCTTGCATTTTTTTGGGG - Intergenic
1002359353 5:178658478-178658500 CTTATTGTTTCATTTTTATGAGG + Intergenic
1002626301 5:180531816-180531838 CTGGTTCTTGCATTTTTTGGTGG - Intronic
1003364758 6:5461907-5461929 CATATGATTTCATTTCTTTGGGG + Intronic
1003702028 6:8477116-8477138 CTGATCCTGGAATTTTTTTGAGG + Intergenic
1004546162 6:16600251-16600273 ATGATGCTTTTATTGGTTTGTGG - Intronic
1004941750 6:20565930-20565952 TTAATGCTTTCAGATTTTTGTGG + Intronic
1004954620 6:20715540-20715562 GTGGTGATTTCATCTTTTTGGGG + Intronic
1005273303 6:24189377-24189399 TTGATGCTTTCAGTATTTTGTGG - Intronic
1005446801 6:25932207-25932229 CTAATTTTTGCATTTTTTTGTGG - Intergenic
1005451343 6:25975891-25975913 CTGGTGCTTTCATTTCTTTTGGG + Intronic
1005770214 6:29062390-29062412 CTGCTGCTTTTTTTTTTTTTTGG + Intergenic
1006554428 6:34853355-34853377 CTGTTTTTTTTATTTTTTTGTGG + Intronic
1006980452 6:38143520-38143542 CTGATATTTTAATTTATTTGGGG + Intronic
1007451529 6:41943255-41943277 ATGATTATTTCCTTTTTTTGTGG - Intronic
1008387487 6:50909294-50909316 CTTAGGCTTTCATTTTTCTTGGG + Intergenic
1008988003 6:57569148-57569170 CTTATGCTCTCATTTTTATATGG + Intronic
1009176614 6:60467732-60467754 CTTATGCTCTCATTTTTATATGG + Intergenic
1009644381 6:66378408-66378430 CTGTTGCTTTCTTTTTTTCTTGG - Intergenic
1009728492 6:67565880-67565902 CTCATTCTTTCTCTTTTTTGGGG + Intergenic
1009767833 6:68104757-68104779 CTGATTTTTTTTTTTTTTTGAGG + Intergenic
1009795395 6:68459772-68459794 CTGAGGTTTTTTTTTTTTTGTGG + Intergenic
1009846043 6:69136344-69136366 TACATTCTTTCATTTTTTTGAGG - Intronic
1009938242 6:70258910-70258932 CTGATACCTTCATTTTTTTCTGG - Intronic
1010276576 6:73974495-73974517 AAGATGCTTTCATTTCTTTGGGG + Intergenic
1010373230 6:75135938-75135960 CTGATGCTAGAATTATTTTGGGG - Intronic
1010582165 6:77613311-77613333 CTCATGATCTCATTTATTTGTGG - Intergenic
1010626980 6:78149662-78149684 CACATGGGTTCATTTTTTTGGGG - Intergenic
1011060494 6:83261005-83261027 CTTCTGCTTTTATTTCTTTGAGG + Intronic
1011095267 6:83654907-83654929 CTGATGGTTTCTGTTTATTGAGG - Intronic
1011176929 6:84573797-84573819 GACATGATTTCATTTTTTTGTGG - Intergenic
1012000760 6:93651895-93651917 ATGTTACTTTCTTTTTTTTGGGG + Intergenic
1012321820 6:97858168-97858190 CTAATATTTTCATTTATTTGTGG + Intergenic
1012425201 6:99106462-99106484 CACATACTTACATTTTTTTGTGG - Intergenic
1013119205 6:107126467-107126489 CTGATTTTTTTTTTTTTTTGAGG + Intergenic
1013375817 6:109513027-109513049 CTAATGTTTTAATTTTTTTATGG + Intronic
1014006715 6:116427885-116427907 CTGATGTTTTAATTTTCTTTAGG - Intronic
1014392515 6:120880635-120880657 CTGATGCTTTCATTTGTCAAAGG - Intergenic
1014737153 6:125106707-125106729 CAGATGGTTTTGTTTTTTTGAGG + Intergenic
1014830562 6:126098223-126098245 CTGCTGCGTTCATTTCCTTGGGG + Intergenic
1014862699 6:126488915-126488937 CTTCTGTTTTCAGTTTTTTGAGG + Intergenic
1015126663 6:129762817-129762839 GTTATGATTTCATTTCTTTGGGG + Intergenic
1015243313 6:131050338-131050360 TTGAGTCTTTCATTTTTTTTTGG - Intronic
1015637736 6:135295410-135295432 GTTATGCTTTCATTTTTCTTGGG - Intronic
1015804082 6:137091070-137091092 CGGATGCTTTTATTTTTCTTGGG - Intergenic
1015851822 6:137582071-137582093 GTGATGCTTACATTTTTTAGTGG - Intergenic
1015977658 6:138807136-138807158 CTAATGGTTGTATTTTTTTGTGG + Intronic
1016498850 6:144694698-144694720 CTGATGGTTGTATTTTTGTGGGG + Intronic
1016774288 6:147887661-147887683 CATATGCTTTCATTTCTTTTGGG + Intergenic
1017224910 6:152009605-152009627 CTGGTGCTTTCATGTTTTGCTGG + Intronic
1017663250 6:156694455-156694477 GTGCTACTTTCAGTTTTTTGAGG - Intergenic
1018326730 6:162678287-162678309 CATATGTTTTCATTTCTTTGGGG + Intronic
1018328529 6:162701889-162701911 CTGTTGGTTTCATTTTGTCGGGG - Intronic
1018338024 6:162816830-162816852 CTCTTGCTTTTAGTTTTTTGTGG - Intronic
1019467059 7:1195747-1195769 CTAATTTTTTAATTTTTTTGTGG - Intergenic
1019579621 7:1754335-1754357 CTTAAGTTTTCATTTTTCTGGGG + Intergenic
1019627414 7:2024816-2024838 CTGGTGCTTTCCTTTTTGGGAGG - Intronic
1020031412 7:4935509-4935531 CTAATTTTTTTATTTTTTTGTGG - Intronic
1020762527 7:12286184-12286206 CTAATTCTTGTATTTTTTTGTGG + Intergenic
1020772962 7:12418931-12418953 CTTATAATTTCATTTTCTTGGGG - Intergenic
1021676795 7:23088396-23088418 CGTATGCTTTCATTTCTTTTGGG + Intergenic
1021704933 7:23357459-23357481 CTTATACTTTCTTTTGTTTGGGG - Intronic
1021727978 7:23568325-23568347 CTCACATTTTCATTTTTTTGTGG + Intergenic
1022675720 7:32496934-32496956 CTAATTTTTTAATTTTTTTGTGG - Intronic
1023134124 7:37033955-37033977 CTAATGCTCTAATTTTTTTTTGG - Intronic
1023139848 7:37091106-37091128 CTTATGTTTTTAGTTTTTTGAGG + Intronic
1023267888 7:38427643-38427665 CTGCTGCTTTTTTTTTTTTTTGG + Intronic
1023323165 7:39022833-39022855 CATATGGTTTCATTTCTTTGGGG + Intronic
1023405506 7:39829762-39829784 CTGAGGCCTTCTTTTTTTTTTGG + Intergenic
1023776596 7:43613676-43613698 CTGATTTTTTTAATTTTTTGTGG - Intronic
1024089838 7:45926353-45926375 GGGTTGTTTTCATTTTTTTGTGG + Intergenic
1024603151 7:51003833-51003855 TTGCTTCTTTCATTTTTTTCTGG - Intergenic
1024908082 7:54410871-54410893 CTGGTGCTTCCATTTCTTTATGG - Intergenic
1025500848 7:61293917-61293939 CTGAAGCTTTCTTTTGATTGAGG + Intergenic
1025515709 7:61640140-61640162 CTGAAGCTTTCTTTTGATTGAGG + Intergenic
1025540045 7:62068966-62068988 CTGAAGCTTTCTTTTGATTGAGG + Intergenic
1026031248 7:66796384-66796406 CTTATCCTTTCATTTTTCTGAGG - Intronic
1026092302 7:67310667-67310689 CTTATTCTTTCTTTTTTTTTTGG + Intergenic
1026157395 7:67838999-67839021 CTTATACTTTTATTTCTTTGGGG + Intergenic
1026234302 7:68512568-68512590 CTTATGTTTTCATTTCTTTTGGG - Intergenic
1026684148 7:72494023-72494045 CTTATTTTTTCATTTTTCTGTGG - Intergenic
1027444142 7:78253076-78253098 CTTATGTTTTCATTTTTCTTGGG - Intronic
1028472885 7:91223949-91223971 CTCTTTCTTTCTTTTTTTTGCGG - Intergenic
1028555467 7:92118852-92118874 CTACTGTTTTCATTTTTTGGAGG - Intronic
1028655305 7:93198579-93198601 CTGTTACTTTCATTTGTTGGAGG - Intronic
1028876609 7:95830684-95830706 CATATGCTTTCATTTCTTTTGGG + Intronic
1030062316 7:105632342-105632364 ATGATGCTTTCCTATTTTTTAGG - Intronic
1030092813 7:105872837-105872859 TTGATGTTTTTTTTTTTTTGTGG - Intronic
1030567430 7:111176532-111176554 CTCATGTTTTCACTTATTTGTGG + Intronic
1030864040 7:114676482-114676504 CTGATGCTTCAATTTTATTATGG - Intronic
1030872036 7:114767555-114767577 CTGAGCATTTCATTTATTTGGGG + Intergenic
1030995179 7:116351548-116351570 CTGCTGATTTCATTGTTTTGGGG - Intronic
1031294498 7:119984191-119984213 CTGGTGCTTTCTTATCTTTGTGG - Intergenic
1032105024 7:129020798-129020820 CTAATGCTCTGTTTTTTTTGAGG - Intronic
1032323050 7:130901638-130901660 CGGCTGCTTTCCTTTTCTTGTGG - Intergenic
1032463383 7:132127904-132127926 CTGAAGCTTTTATTTTTTACTGG - Exonic
1033007005 7:137576722-137576744 GTGTTGATTTCATTATTTTGTGG - Intronic
1033071972 7:138211121-138211143 TTGTTGCTTTTACTTTTTTGTGG - Intergenic
1033375622 7:140759198-140759220 CTGATGGTTTCATTTATTTTGGG + Intronic
1033488184 7:141812421-141812443 CTTATAGTTTCATTTATTTGGGG - Intergenic
1033813717 7:145047691-145047713 CTCATGTTTTCACTTATTTGTGG - Intergenic
1034294125 7:149956891-149956913 TTGATGCTTTAAATTTTGTGGGG + Intergenic
1034649590 7:152679266-152679288 CTGATGATTTCTTTTTTAGGAGG - Intergenic
1034651357 7:152693324-152693346 CTGAAGCTTTTTTTTTTTTTTGG + Intergenic
1034811942 7:154139981-154140003 TTGATGCTTTAAATTTTGTGGGG - Intronic
1035414665 7:158673006-158673028 CTGGTGCTTTCATGCTTCTGAGG - Intronic
1035707077 8:1684255-1684277 CAGATACCTTCATCTTTTTGTGG + Intronic
1036476720 8:9099833-9099855 CACATGCTTTCATTTCTTTTGGG + Intronic
1036547772 8:9788764-9788786 CTTCTGCTTTCAATTGTTTGGGG - Intergenic
1036748949 8:11431064-11431086 CTTTTGCCTTCATTTGTTTGGGG - Intronic
1037143358 8:15543676-15543698 CTAATGCTTTCATTTAAATGAGG - Intronic
1037182459 8:16024200-16024222 TTGATGATTTTATTTTTCTGTGG + Intergenic
1037412354 8:18612276-18612298 CTGATGCTTTCAGTTACTTCAGG + Intronic
1037915857 8:22773047-22773069 CAGATTCTTTCATTTTTCTTTGG - Intronic
1038138424 8:24815947-24815969 GTGATGCTTTCATTTTTGAGCGG - Intergenic
1038143050 8:24867145-24867167 CAGGGGCTTTCATTTTTTTTAGG - Intergenic
1038210065 8:25509314-25509336 CTAATTCATTCATTTTTTTGGGG - Intergenic
1038616090 8:29096462-29096484 CTGATTTTTGTATTTTTTTGTGG + Intronic
1040106124 8:43543047-43543069 CACATCCTTTCATGTTTTTGTGG - Intergenic
1040617482 8:49052161-49052183 CTGATCCTTTGTTTGTTTTGGGG + Intergenic
1040854622 8:51936083-51936105 CTGCTGCTTTCAGTTCTTTTGGG + Intergenic
1040925553 8:52678442-52678464 AGTATGCTTTCATTTATTTGGGG + Intronic
1041619124 8:59944706-59944728 CTAATTTTGTCATTTTTTTGAGG + Intergenic
1042033864 8:64508483-64508505 CTTGTGCTTTCATTTCTTTTGGG - Intergenic
1042368890 8:67968342-67968364 CTGGTGCTGACATTTTTTTCAGG + Intronic
1042398468 8:68317953-68317975 GTGTTGCTTTCATTTTTGAGAGG - Intronic
1042582762 8:70299781-70299803 CTGATGTTTTCATTTCTCTTGGG + Intronic
1042738191 8:72012369-72012391 CTAATTTTTTAATTTTTTTGTGG + Intronic
1042786918 8:72558032-72558054 CTTATTCATTCATTTTTTGGGGG + Intronic
1042958998 8:74282573-74282595 CACATGGTTTCATTCTTTTGCGG + Intronic
1043025238 8:75059020-75059042 CAGATTCATTGATTTTTTTGAGG - Intergenic
1043191125 8:77224713-77224735 CTGATTCTTTCTCGTTTTTGTGG + Intergenic
1043394666 8:79824991-79825013 CTGATTTTTGTATTTTTTTGTGG + Intergenic
1044212065 8:89561708-89561730 CTGCTGCTTTCTTCTCTTTGGGG + Intergenic
1044250357 8:89998817-89998839 CAGATGGTTCCATTCTTTTGAGG - Intronic
1044371554 8:91418230-91418252 CTTAAGCTTTCATTGTTTTCTGG + Intergenic
1044375218 8:91462282-91462304 CTGATCCATTCATTGTTTTATGG - Intergenic
1044602163 8:94016350-94016372 CTGGTGCTTTCATTTTGTTTAGG - Intergenic
1044678343 8:94752043-94752065 CATATGCTTTCATTTCTTTTGGG + Intronic
1044828581 8:96222671-96222693 ATGGTGGTTTCATTTTTTGGAGG - Intergenic
1044844209 8:96364358-96364380 TTAATTCTTTTATTTTTTTGTGG - Intergenic
1045650180 8:104334845-104334867 CATATGCTTCCATTCTTTTGAGG - Intronic
1045766710 8:105680947-105680969 CTGATGCTTTTTTGTATTTGTGG - Intronic
1045939643 8:107724969-107724991 CTGTTACTTTCATTTTATAGAGG - Intergenic
1046344976 8:112912244-112912266 ATACTGCTTTCATTTTTTTTTGG + Intronic
1047038134 8:120962407-120962429 CATATGATTTCATTTTTTTTGGG + Intergenic
1047932315 8:129741728-129741750 CTGTTGCTTTTAGTTTTTTGAGG - Intergenic
1048158493 8:131988291-131988313 CTTATGCTTTCATTTTAATTTGG + Intronic
1048431773 8:134377496-134377518 CTGGTGGTTTCATATTGTTGAGG + Intergenic
1048819476 8:138367410-138367432 ATAATGCTTTCATCTTTTTGAGG - Intronic
1050114562 9:2250478-2250500 CTGGTTTTTTAATTTTTTTGTGG - Intergenic
1050766212 9:9137929-9137951 CTGATGCATGAATTCTTTTGGGG - Intronic
1050790504 9:9462891-9462913 ATGATTCTTTCATTTTTTGTGGG - Intronic
1051175045 9:14352251-14352273 CTGATTTTTTCATTTTTTTTTGG + Intronic
1051241384 9:15060373-15060395 CTGCTGTTCTCATTTTTATGAGG + Intergenic
1051651928 9:19335335-19335357 CATATGCCTTCATTGTTTTGTGG + Intronic
1051879492 9:21825417-21825439 TTGATATTTTCAGTTTTTTGGGG + Intronic
1051973233 9:22916578-22916600 CAGATGCTTTCATTTCTTTCGGG - Intergenic
1052181160 9:25530076-25530098 CACTTGCTTTCATTCTTTTGTGG + Intergenic
1053416193 9:37948288-37948310 ATGGTCCTTTGATTTTTTTGAGG - Intronic
1053624523 9:39854955-39854977 GTGATGCTTTTTTTTTTTTTTGG + Intergenic
1053694296 9:40621263-40621285 CTGATGGTAACATTTTTTTCAGG - Intergenic
1053941285 9:43251669-43251691 CTGATGGTAACATTTTTTTCAGG - Intergenic
1054270540 9:63018865-63018887 CTGATGGTAACATTTTTTTCAGG + Intergenic
1054305541 9:63420487-63420509 CTGATGGTAACATTTTTTTCAGG - Intergenic
1054359078 9:64095279-64095301 ATTATGTTTTCCTTTTTTTGAGG + Intergenic
1054404287 9:64744474-64744496 CTGATGGTAACATTTTTTTCAGG - Intergenic
1054437909 9:65229971-65229993 CTGATGGTAACATTTTTTTCAGG - Intergenic
1054492495 9:65791991-65792013 CTGATGGTAACATTTTTTTCAGG + Intergenic
1054974296 9:71123908-71123930 ATGATGCTGTCATTTTTGTGGGG - Intronic
1055419729 9:76126314-76126336 CAGCTGATTTCATTTTTTTATGG - Intronic
1055434344 9:76277273-76277295 CTGAAGCCTTCATTCTTTGGGGG - Intronic
1055576779 9:77668194-77668216 CTCCTGCTTTCAATTATTTGGGG - Intergenic
1055652719 9:78422589-78422611 GTGTTGCTTTTTTTTTTTTGAGG - Intergenic
1055738030 9:79353957-79353979 CTAATTTTTTTATTTTTTTGTGG - Intergenic
1055776093 9:79768590-79768612 CTAATGTTTTCATTTTGTTTTGG + Intergenic
1055823364 9:80295165-80295187 CTGATGGTTTTATTTCTGTGGGG - Intergenic
1056075248 9:83031746-83031768 TTCATGCTTTCATTCTTTTAAGG - Intronic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1056618484 9:88189378-88189400 AAGATGCTTGCATTTCTTTGTGG - Intergenic
1056647644 9:88428703-88428725 CTTATTCTTTGATTTTTTTATGG + Intronic
1056934301 9:90904005-90904027 CTGATGCTTTGAAATCTTTGAGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057318533 9:93989771-93989793 CTGATGATTTTTTTTTTTTCAGG - Intergenic
1057393494 9:94658862-94658884 CATATGCTTTCATTTCTTTTGGG + Intergenic
1057445841 9:95113920-95113942 CTAATGTTTAAATTTTTTTGTGG - Intronic
1057762028 9:97883741-97883763 CATATGCTTTCATTTTTCTTGGG - Intergenic
1058183639 9:101827814-101827836 CTGATGTTTTTATCTTTTTGTGG + Intergenic
1058964537 9:110024399-110024421 ATGATGATTTTTTTTTTTTGAGG + Intronic
1059031820 9:110706262-110706284 ATAATGCTTTCATTTCTGTGAGG - Intronic
1059511437 9:114851820-114851842 TTGATGCATGCATTGTTTTGAGG + Intergenic
1060059654 9:120447691-120447713 CTATTGCTTTCATTTTATTCTGG - Intronic
1060098369 9:120814166-120814188 CTTATTCTCTCATGTTTTTGAGG + Intergenic
1061558359 9:131386276-131386298 CTAATTTTTTAATTTTTTTGTGG + Intergenic
1061989941 9:134153422-134153444 CTGATGCGTTCATCTCTGTGAGG + Intronic
1062541193 9:137042253-137042275 CTGCTGCTTTTTTTTTTTTGAGG + Intronic
1203704373 Un_KI270742v1:25116-25138 ATTATGTTTTCCTTTTTTTGAGG + Intergenic
1203559627 Un_KI270744v1:40706-40728 ATTATGTTTTCCTTTTTTTGAGG - Intergenic
1185738592 X:2512292-2512314 TTGATGCTTTCATGTCCTTGTGG - Intergenic
1185828195 X:3273034-3273056 GTCATGATTTCATTCTTTTGGGG + Intronic
1186063310 X:5734727-5734749 TTGATGCATCCATTTGTTTGTGG + Intergenic
1186063381 X:5735894-5735916 CTTATGCTACCATTTTGTTGAGG + Intergenic
1186188234 X:7042642-7042664 CATATGTTTTCATTTTTTGGGGG + Intergenic
1186978721 X:14936322-14936344 CTTATTTTTTTATTTTTTTGTGG - Intergenic
1187167022 X:16813756-16813778 TTAATGCATTCATTTTTGTGTGG - Intronic
1187657760 X:21497766-21497788 CTGATGCTGTCTTTTTCTTAGGG + Exonic
1188082238 X:25858108-25858130 GAAATGCTTTCTTTTTTTTGTGG + Intergenic
1188509403 X:30919152-30919174 CTGATACTTTTTTTTTATTGTGG + Intronic
1188931293 X:36114450-36114472 CTGGTTCTTTCAAATTTTTGTGG + Intronic
1189172325 X:38921429-38921451 TTGATGACTTCATTTTTTTTAGG + Intergenic
1189290219 X:39879628-39879650 CTGATATTTTGATTTTTTTTTGG - Intergenic
1189703738 X:43738652-43738674 CTAATTTTTTTATTTTTTTGTGG - Intronic
1189757744 X:44288060-44288082 CTGTTGCTTTTATTTTGTTTGGG - Intronic
1189925754 X:45952778-45952800 CTGATGAGTTCATCTTATTGAGG + Intergenic
1189953338 X:46254531-46254553 CTGATCCTTTCAGTTATTTTAGG - Intergenic
1190039922 X:47062701-47062723 CTGATGATTTTTTTTTTTTTAGG + Intergenic
1190081440 X:47359670-47359692 CTGATGCTTTTGGTTTTTTATGG + Intergenic
1190360121 X:49640960-49640982 CTTATACTATCATTTCTTTGGGG + Intergenic
1190491306 X:50984938-50984960 CATATGCTTTCATTTTTCTTAGG - Intergenic
1190500027 X:51065934-51065956 CTTATGGTTTCATTTTCTTTTGG - Intergenic
1190642009 X:52488974-52488996 ATACTGCTTTCATTTCTTTGGGG + Intergenic
1190645664 X:52523892-52523914 ATACTGCTTTCATTTCTTTGGGG - Intergenic
1191014864 X:55798245-55798267 CTGATTTTTGCATTTTTTTGTGG - Intergenic
1191024747 X:55901633-55901655 CTGCTGATTTCATTTTGTTTGGG + Intergenic
1191160843 X:57328663-57328685 CTGGTTCTTTCTTATTTTTGTGG + Intronic
1191701377 X:64046258-64046280 CTCATGCTCTCACTTATTTGTGG + Intergenic
1191708824 X:64125172-64125194 CAAATTCTTTCAGTTTTTTGAGG - Intergenic
1191979473 X:66910200-66910222 CTGGTGCTTACATTTTAGTGAGG + Intergenic
1192497513 X:71626160-71626182 CTGATACTTTTTTTTTTTTGAGG - Intergenic
1192536304 X:71930883-71930905 CATATGCTTTCATTTTTCTTGGG + Intergenic
1192819426 X:74628535-74628557 CTAATTTTTTAATTTTTTTGTGG + Intergenic
1193194072 X:78609241-78609263 CTGTTTCTTTCTCTTTTTTGGGG + Intergenic
1193249223 X:79268406-79268428 CTGATGCTTTCCTTGGTTTATGG + Intergenic
1193552932 X:82921295-82921317 CTTTTCCTTTCATTTTTGTGGGG + Intergenic
1193585342 X:83314616-83314638 CATATGTTTTCATTTATTTGTGG + Intergenic
1194072367 X:89341804-89341826 GTAATGCTTTCAGTTTTTTTGGG - Intergenic
1194269760 X:91797686-91797708 CTGCTGGTTTTATTTTTATGTGG + Intronic
1194361553 X:92957556-92957578 CTAATGTTTTCATTTATTTTAGG + Intergenic
1195152649 X:102088178-102088200 GTAATACTTTCATTTTTTGGGGG + Intergenic
1195171698 X:102274902-102274924 CTGATGTTCTCACTTATTTGTGG - Intergenic
1195187162 X:102412191-102412213 CTGATGTTCTCACTTATTTGTGG + Intronic
1195653105 X:107307447-107307469 TTCATGCCTTCCTTTTTTTGTGG - Intergenic
1195911614 X:109893865-109893887 CTCATGTTTTCACTTATTTGTGG - Intergenic
1196355147 X:114782550-114782572 CTAATCTTTTAATTTTTTTGTGG - Intronic
1196966064 X:121056406-121056428 CTAATGTTTTTATCTTTTTGGGG + Intergenic
1198411487 X:136373798-136373820 CTAATTTTTTAATTTTTTTGTGG - Intronic
1198839556 X:140841738-140841760 CTGATGCCTGCTTTTTTTGGGGG + Intergenic
1198985913 X:142453345-142453367 CTGGTGGTTTCATTTGTTTTTGG - Intergenic
1199079808 X:143564248-143564270 CTGGTGGTTTTATTTTTTGGGGG - Intergenic
1199144365 X:144348277-144348299 CTGCTGATGTCATTTTTTGGTGG + Intergenic
1199195654 X:145026962-145026984 CTTAGGCTTCCATATTTTTGTGG - Intergenic
1199196594 X:145038696-145038718 CTGCTGTTTTTATTTTTTGGAGG - Intergenic
1199318216 X:146405768-146405790 ATTATGCTTCCATTTTTTTCTGG + Intergenic
1199581767 X:149367634-149367656 CTGATGATTTCAGTTTTCTCAGG + Intergenic
1199583075 X:149379986-149380008 CCCATGCTTTCATACTTTTGTGG - Intergenic
1200036227 X:153333531-153333553 CATATGCTTTCATTTTTCTTGGG - Intergenic
1200306947 X:155036003-155036025 CATATGCTTTCATTTCTTTTGGG + Intronic
1200415779 Y:2908293-2908315 CTAATGTTTTTATTCTTTTGTGG + Intronic
1200586977 Y:5018667-5018689 CTGCTGGTTTTATTTTTATGTGG + Intronic
1200669747 Y:6073431-6073453 CTAATGTTTTCATTTATTTTAGG + Intergenic
1200726607 Y:6677550-6677572 GTAATGCTTTCAGTTTTTTTGGG - Intergenic
1200727759 Y:6693326-6693348 GTAATGCTTTCAGTTTTTTTGGG - Intergenic
1200873834 Y:8131374-8131396 GTGATGGGTTAATTTTTTTGAGG + Intergenic
1201192104 Y:11453178-11453200 CTGATGGTAACATTTTTTTCAGG - Intergenic
1201274133 Y:12282976-12282998 GTGATGCTTTCTTTTTAGTGGGG + Intergenic
1201382289 Y:13395169-13395191 TTGTTGCTTTTGTTTTTTTGAGG - Intronic
1201383343 Y:13411113-13411135 CTTATGTTTTTATTTTTTTCAGG - Exonic
1201600338 Y:15721489-15721511 CAGTTGATTTCATTTTTTTAAGG + Intergenic