ID: 958029077

View in Genome Browser
Species Human (GRCh38)
Location 3:88085347-88085369
Sequence GGTTTTATTGGAACACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 22, 3: 62, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958029077 Original CRISPR GGTTTTATTGGAACACAACC AGG (reversed) Intronic
901083415 1:6596537-6596559 AGTTTTCTTGGCACACAGCCAGG - Intronic
901491044 1:9596460-9596482 AGTTTTATTGGAACACAGCCAGG - Intronic
902539367 1:17142212-17142234 AGTTTTATGGGGACACAGCCAGG - Intergenic
903370786 1:22834595-22834617 AGTTTTATTGGCACACAGCCAGG - Intronic
905783373 1:40732287-40732309 GGTTTTATTGCAATATGACCTGG - Intronic
906950139 1:50328240-50328262 GGTTTTGTTTCAAAACAACCTGG + Intergenic
911949813 1:104158060-104158082 GGGATTATTGGAAAACAAGCAGG - Intergenic
915044943 1:153004563-153004585 GGTTATTTTGGAACACCACTGGG - Intergenic
917337328 1:173939084-173939106 AGTTTTATTGGAATATAGCCTGG + Intronic
917430061 1:174957155-174957177 AGTTTTCTTGGAACACAGCCAGG + Intronic
917434586 1:175007323-175007345 TGTTTTATTGGGACATAGCCAGG + Intronic
918466016 1:184822463-184822485 TGTTTTCTTGGCACACAGCCAGG - Intronic
923439864 1:234007069-234007091 AGTTTTACGGGAACACAACCAGG - Intronic
1063128517 10:3157239-3157261 TATTTTATTGGAACAAAACAGGG - Intronic
1064257902 10:13760112-13760134 AGTTTTATTGGAACACAATCAGG + Intronic
1064993817 10:21279190-21279212 AGTTTTATTGGAATGCAGCCAGG - Intergenic
1065133188 10:22643281-22643303 CGTTTTATTGGAACAGAGCCAGG + Intronic
1065872206 10:29965187-29965209 AGTTTTATTGGAATACAGTCAGG + Intergenic
1065947749 10:30622670-30622692 AGTCTTATTGGAACACAGCCAGG + Intronic
1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG + Intronic
1067525796 10:47037838-47037860 AGTTTTATTGGAATGCAGCCAGG - Intergenic
1068075119 10:52243137-52243159 AATTTTATTGGAACACACACAGG + Intronic
1070379769 10:75870220-75870242 AGTTTTATTGGAACACAGCTGGG + Intronic
1071262510 10:83933599-83933621 GATTTTATTGGGACACCGCCAGG + Intergenic
1071599550 10:86951584-86951606 AGTTTTATTGGAGCACAGACAGG - Intronic
1071838487 10:89444101-89444123 GGTTTTATGGAAACAAAAGCAGG + Intronic
1073227483 10:101935260-101935282 GTCTTTATTGGAACACAAACAGG - Intronic
1073552708 10:104418086-104418108 AGTTTTATTGGCACACAGCCAGG + Intronic
1075443849 10:122500369-122500391 GGATTTTTTGGAAAGCAACCAGG + Intronic
1075576006 10:123578029-123578051 AGTTTTATTGGAACACCGCCAGG + Intergenic
1077596220 11:3533994-3534016 AGTTTTACTGGAATAAAACCAGG + Intergenic
1078123272 11:8532317-8532339 AGTTTTATTGGAATACATACAGG + Intronic
1079890030 11:26040694-26040716 GATTTTATTTGATTACAACCTGG + Intergenic
1080990878 11:37533274-37533296 GGTCTTATTGGACCCCACCCAGG - Intergenic
1081585444 11:44380770-44380792 AGCTTTATTGGAACACAGCCAGG + Intergenic
1083799864 11:65040555-65040577 AAATTTGTTGGAACACAACCAGG + Exonic
1084252128 11:67907974-67907996 AGTTTTACTGGAATAAAACCAGG + Intergenic
1084796054 11:71504770-71504792 GGTTCTATTGGAACACAGCCAGG - Intronic
1084820719 11:71688060-71688082 AGTTTTACTGGAATAAAACCAGG - Intergenic
1085541326 11:77273031-77273053 GGTTTTATTGTAAACAAACCTGG - Intronic
1087803257 11:102527251-102527273 AGTTTTACTGGAACACAGTCAGG - Intronic
1088064029 11:105693828-105693850 AGTTTTATTGGAACATAGCCAGG + Intronic
1088314722 11:108496419-108496441 AGTTTTATTGTAACATAAACGGG + Intronic
1089752937 11:120664291-120664313 GCTTTCATTAGAACCCAACCAGG - Intronic
1090810706 11:130239495-130239517 AGTATTACTGGAACACAACCAGG - Intronic
1092084865 12:5748378-5748400 TGTTTTCTTAGAACACACCCAGG + Intronic
1092355152 12:7788638-7788660 GGTTATAGTGAAACACAACATGG - Intronic
1092764553 12:11840977-11840999 GGTTTCATTGGAACACAAAGAGG - Intronic
1102620127 12:114187962-114187984 AGTTTAATTGGAACACAGCTGGG - Intergenic
1102628490 12:114255631-114255653 GGTTTTAGTGGGACACTTCCTGG + Intergenic
1102788449 12:115623446-115623468 AGTTTTATTGGAACACAGCCTGG + Intergenic
1105897502 13:24728659-24728681 GGTTTTATTAAAACAAAAACAGG + Intergenic
1106141888 13:27018771-27018793 AGTTTTCCTGGAACACAGCCAGG + Intergenic
1107106769 13:36651805-36651827 AGTTTTATTGGAACAAAGCCAGG + Intergenic
1110307136 13:74001446-74001468 GGTGTTGTTGGAACACAGCTAGG + Intronic
1115378883 14:32710893-32710915 AGTTTTGTTGGAACACTGCCAGG + Intronic
1116693683 14:48144756-48144778 GCTTTGATTGAAACAGAACCAGG - Intergenic
1118542177 14:66840592-66840614 AGTTTTATTAGAGCACAGCCAGG - Intronic
1121435414 14:93915974-93915996 AGTTTTATTGGAACACAGCCAGG - Intergenic
1121517800 14:94564613-94564635 AGTTTTATTGGCACACAGCCAGG + Intronic
1125419867 15:39494299-39494321 GGTTTTTTTAGAACACTAACTGG - Intergenic
1125703783 15:41712817-41712839 AGTTTCACTGGAACGCAACCAGG - Intronic
1126858724 15:52863471-52863493 AGCTTTATTGGAACACAGCTAGG - Intergenic
1127199557 15:56629206-56629228 AGTTTTACTGGAACACAAATAGG + Intergenic
1127384387 15:58455335-58455357 AGGTTTATTGGAACACAGCCAGG - Intronic
1128324393 15:66714468-66714490 GTTTTACTTGGAACACAGCCAGG + Intronic
1128496497 15:68201315-68201337 GGTTTTATGGGAACTAAACCTGG - Intronic
1129868668 15:78927320-78927342 GTTGTTATTGCAACAGAACCTGG + Intronic
1131979817 15:97983974-97983996 CGTTTTATTGAAACACTAACAGG - Intergenic
1133155762 16:3874482-3874504 AGTTTTACTGGAACACAGCCAGG + Intronic
1133743651 16:8670948-8670970 AATTTTATGGGAACACAGCCAGG - Intergenic
1133888515 16:9854955-9854977 GGTTATATTTATACACAACCAGG + Intronic
1133974766 16:10592773-10592795 AGTTTTATTGGAACACAGCCAGG - Intergenic
1134232909 16:12442886-12442908 AGTTTTTTTTGAACACAGCCAGG - Intronic
1135062422 16:19282320-19282342 AGTTTTATTGGCACACTGCCTGG + Intergenic
1135151148 16:20007131-20007153 AGTTTTATTGGAACACAGCCAGG + Intergenic
1135600645 16:23780507-23780529 AGTTTTATTGGAACACAGCCAGG - Intergenic
1135652556 16:24218826-24218848 TGTTTTATTACAAGACAACCAGG - Exonic
1135742330 16:24986552-24986574 AGTTTCACTGGAACACAGCCAGG + Intronic
1135754097 16:25082071-25082093 AGTTTTATTGGAACACAGCCAGG - Intergenic
1138401701 16:56750661-56750683 AGTTTTATTGGAACACAGCCAGG + Intronic
1138918821 16:61501859-61501881 GGTCTTATTTGAACTCAGCCTGG + Intergenic
1140880159 16:79190737-79190759 AGTTTTATTGGAACACAGCCAGG + Intronic
1140923953 16:79565253-79565275 AGCTTTATTGAAACACAACCAGG + Intergenic
1142897008 17:2987110-2987132 AGTTTTATTGGAACGCAGACAGG - Intronic
1143379280 17:6485861-6485883 AGTTTTATTGGAACACACTCAGG + Intronic
1143971163 17:10797004-10797026 TGTTTTATTGGAACACAGACTGG - Intergenic
1144308113 17:13987572-13987594 GATTTTCTTGGAACACAGCCAGG - Intergenic
1146438336 17:32872247-32872269 GGTTTTGTTAGAACACAAGCAGG + Intronic
1147906872 17:43829306-43829328 AGCTTTTTTGGAGCACAACCAGG - Intronic
1148586998 17:48788032-48788054 GGTTTTCTTGGGACAAAGCCTGG + Intronic
1149253215 17:54794287-54794309 AGTTTTATTTGAACACCACCAGG + Intergenic
1152113602 17:78371205-78371227 GGTTTTATTGAATCACAGCCAGG + Intergenic
1152673195 17:81621671-81621693 AGTGTTATTGGAACACAGCCAGG - Intronic
1155912577 18:31521536-31521558 AGTTTTATTGGACCACAGCTAGG - Intronic
1157426697 18:47590483-47590505 AGTTTTTTTGGAAAACACCCTGG - Intergenic
1157525660 18:48378519-48378541 GGTTTTATTGGAGAACCATCTGG - Intronic
1158361948 18:56684456-56684478 AGTTTTATCGCAACACAGCCAGG - Intronic
1161585980 19:5105867-5105889 AGTTTTATTGGCACATAGCCAGG - Intronic
1164208085 19:23074393-23074415 GTGTTTACTGCAACACAACCAGG - Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1168352065 19:55681532-55681554 AGTTTTATTGGAACACAGCCAGG + Intronic
932858962 2:75268292-75268314 AGTTTTGTTGGAACACAGCCAGG + Intergenic
933239394 2:79903054-79903076 AGTTTTATTAGAACACAGTCAGG - Intronic
933612209 2:84448283-84448305 AGTTTTATTGGAACGCACCCAGG + Intronic
935552120 2:104468597-104468619 GGTTTTATTGCCACACACCCAGG - Intergenic
938678798 2:133667485-133667507 GGTCTGAGTGGAAAACAACCTGG - Intergenic
938757728 2:134396177-134396199 GGTTTGAGTGGGACACAACAAGG + Intronic
938844485 2:135194873-135194895 GGATTTATTTGAACAAAATCAGG + Intronic
940124076 2:150304263-150304285 AGCTTTATTGGAACATAGCCAGG - Intergenic
941147046 2:161860986-161861008 AGTTTCATTGGAGCATAACCAGG + Intronic
941212993 2:162666523-162666545 GGTTTTATTTGAACATAGCAGGG - Intronic
942691562 2:178590631-178590653 GCTTTTATTGGATCAGAACTTGG + Exonic
943928548 2:193819925-193819947 GGTGCTGTTGCAACACAACCAGG - Intergenic
945772979 2:214068401-214068423 GGTTTTATTAGAACAAATCAAGG - Intronic
945855804 2:215068423-215068445 AGTTTTATTGGAATACAACCAGG - Intronic
946041820 2:216789284-216789306 AGTTTTCTTGGATCACAGCCCGG - Intergenic
946918978 2:224558502-224558524 GGTTTTATTGGCATAAAATCAGG - Intronic
948042117 2:234910895-234910917 AATTTTATTTGAAAACAACCAGG + Intergenic
948345914 2:237297975-237297997 GGTTTGATTCGAGCACAACTGGG - Intergenic
1170346763 20:15395601-15395623 AGTTTTATTGGAACACAGCCAGG - Intronic
1173228565 20:41176576-41176598 TGTCTTTCTGGAACACAACCTGG + Intronic
1173408357 20:42786999-42787021 AGTTTTGTTGGAACACAGCTGGG + Intronic
1174284979 20:49466097-49466119 GGTTTTAATGGAACACAGGCAGG - Intronic
1174785173 20:53425718-53425740 AGTTTTATTGGAACATGGCCTGG - Intronic
1174889979 20:54381415-54381437 AGTTTTATTGAAAGACAGCCAGG + Intergenic
1175763863 20:61579629-61579651 TGTTTTCAGGGAACACAACCTGG - Intronic
1175815706 20:61882210-61882232 GGCTTTATTGGCACACAGCGTGG + Intronic
1176938585 21:14896756-14896778 GAAAATATTGGAACACAACCAGG + Intergenic
1178425139 21:32473232-32473254 GGTGTTGTTGGAACACACGCAGG - Intronic
1178470449 21:32887645-32887667 TATTTTATTAGAACACATCCTGG + Intergenic
1178577214 21:33805543-33805565 AGTTTTATTGGAACACAGCCAGG + Intronic
1178855418 21:36246324-36246346 GATTGTCTTGGAACACCACCTGG + Exonic
1179170044 21:38965933-38965955 GGTTTCATTGGCACTCAGCCAGG + Intergenic
1180625913 22:17193325-17193347 GGTTTTATTTAAACACAAAAAGG - Intronic
1181880352 22:25974631-25974653 AGTTTTATTGGAGCACAACTAGG - Intronic
1182656350 22:31893279-31893301 AGTTTTATTGGAATACAGCCAGG + Intronic
1183121598 22:35734256-35734278 AGTTTTATTGGAAGATTACCAGG + Intergenic
1183701880 22:39455715-39455737 AGTTTTATTGGAACACCGCCAGG + Intergenic
1184025289 22:41851309-41851331 GGTTTAATTGGAATCTAACCTGG + Intronic
1184601510 22:45546512-45546534 AGTTTTATTAGAACACAGCCCGG - Intronic
949867212 3:8555911-8555933 AGTTTGATTGGAACACAGCCAGG - Intronic
950087051 3:10266685-10266707 GGTTTCATTGGAATACAGTCAGG - Intronic
951734154 3:25844916-25844938 AGTTTTATTGGAACACAACTAGG + Intergenic
953795958 3:45986190-45986212 GGACTTATTGGAAAACCACCAGG - Intronic
955310583 3:57882634-57882656 AGTTTTATGAGAACACAGCCAGG - Intronic
955743552 3:62118304-62118326 AGTTTTATTGGAACACAGTCAGG - Intronic
957307647 3:78478872-78478894 TGTTTTCTTGGAACACAGGCTGG - Intergenic
958029077 3:88085347-88085369 GGTTTTATTGGAACACAACCAGG - Intronic
961352659 3:126313943-126313965 AGTTTTATTGGCACACAGCCAGG + Intergenic
961848778 3:129794111-129794133 AGTTTTAGGGGAACACAATCTGG + Intronic
962077040 3:132093183-132093205 AGTTTTATTGGAACACAGCCAGG - Intronic
963775882 3:149439103-149439125 AGTATTATTGGAACACAGTCAGG + Intergenic
963818642 3:149863212-149863234 GTTTATAGTTGAACACAACCTGG - Intronic
965080440 3:164025172-164025194 TATTTTATTGTAACACAGCCTGG - Intergenic
966317259 3:178661562-178661584 AGTTTTACTGGAACACAGCCAGG - Intronic
967198095 3:187046879-187046901 AGTTTTGTTGGAACATAGCCAGG - Intronic
967395730 3:189006811-189006833 AGTTTTATTGGAATACAGCCAGG + Intronic
969010791 4:4060440-4060462 AGTTTTACTGGAATAAAACCAGG + Intergenic
969802649 4:9581546-9581568 AGTTTTACTGGAATAAAACCAGG - Intergenic
971021346 4:22539359-22539381 AGTTTCATCGGAACACAGCCAGG - Intergenic
972297070 4:37749622-37749644 AGTTTTATTGAAAAACAACCAGG + Intergenic
972616157 4:40700338-40700360 GTTCTTATTGGAACACAGACAGG - Intergenic
972647148 4:40979972-40979994 AGGTTTTTTGGAACAAAACCAGG + Intronic
975620640 4:76292848-76292870 GGTTTGAATGGAACAAAGCCAGG - Intronic
981582077 4:146259953-146259975 CTTTTTATTAGAACACAACAAGG + Intronic
987990990 5:25212527-25212549 GTTTGTAGTGGAACACAGCCAGG + Intergenic
988739332 5:34054515-34054537 AGTTTTGTTGGAACACAGCCCGG - Intronic
989367784 5:40675870-40675892 GGTTTTATAGGGACCCAGCCTGG + Intergenic
990425247 5:55681862-55681884 ATTTTTACTGGAACACAGCCAGG + Intronic
990800044 5:59590913-59590935 GGTTTTATTGGAAAAGGACGTGG - Intronic
992667840 5:79028411-79028433 GGTAAGATTGGAAAACAACCTGG - Exonic
993097472 5:83496306-83496328 GGTTACATTGGGACACAAACTGG - Intronic
994721624 5:103386813-103386835 GGTTTTATTGTAAAATAACCAGG - Intergenic
996633759 5:125666548-125666570 TTTTTTATTGCAACACAGCCTGG - Intergenic
998486254 5:142505079-142505101 TGTTCTATTGAAACACACCCAGG - Intergenic
998817719 5:146030846-146030868 AGTTTTATTGGTACTCAGCCAGG + Intronic
1000045048 5:157515577-157515599 AATTTTACTGGAACACAGCCAGG - Intronic
1003045694 6:2730943-2730965 GATATTTTTGGACCACAACCAGG - Intronic
1003380196 6:5618096-5618118 AGCTTCATTGGAACACAACCAGG - Intronic
1004057203 6:12151795-12151817 AGTTTTATTGGAACACAGCCAGG - Intronic
1004077847 6:12361533-12361555 AGTTTTATTGGAATACAATCAGG - Intergenic
1004620455 6:17326436-17326458 TCTTTTATTGTAACACAGCCTGG - Intergenic
1004895505 6:20143949-20143971 AGTTATATTGGAACGCAACCAGG - Intronic
1005080361 6:21951053-21951075 AGTTTTGTTGGAACACAGCCAGG + Intergenic
1005151412 6:22755965-22755987 AGTTTTATTGGAACACAGCCAGG + Intergenic
1006298328 6:33179827-33179849 GGCTTTCTTGGAAGAGAACCTGG - Intronic
1006880921 6:37339046-37339068 AGTTTTACTGGAACACAGCCTGG + Intergenic
1013664835 6:112337022-112337044 GGTTTGATTGTAAAAAAACCAGG + Intergenic
1014180812 6:118382317-118382339 AGTTTTATTGGAACACAGCCAGG - Intergenic
1014522175 6:122457955-122457977 GGTTTTGTAGGACCAGAACCTGG + Intronic
1015343442 6:132128613-132128635 AGTTTTATTGGAATTCAGCCAGG + Intergenic
1015561078 6:134516692-134516714 AGTTTTATTGAAACACTGCCAGG - Intergenic
1017928653 6:158933102-158933124 GGTTTTATTGGAACAGTCTCAGG + Intergenic
1020412716 7:7911150-7911172 GTTCTTATGGTAACACAACCTGG - Intronic
1021090268 7:16474625-16474647 GGTTATATTAGAACACAAGCAGG + Intronic
1021504540 7:21367287-21367309 AGTTTTATTGGAACACAGCCAGG - Intergenic
1022519194 7:30994918-30994940 GCATTTGTTGGCACACAACCTGG + Intergenic
1022774666 7:33513624-33513646 GGTTTTATAAGAACAAAACCTGG + Intronic
1022897322 7:34764434-34764456 AGTTTTATTGGATTACAGCCAGG + Intronic
1023630703 7:42161292-42161314 TGTTTTGTTGGAACACAGCCAGG + Intronic
1026109565 7:67448328-67448350 GATTTTATTGGATCAATACCAGG - Intergenic
1029070077 7:97888450-97888472 AGTTTTACTGGAATAAAACCAGG + Intergenic
1029960416 7:104684464-104684486 AGTTTTATTGGAACACAGCTAGG - Intronic
1031148662 7:118027086-118027108 GGTATTATTGTAACAAAAACTGG + Intergenic
1032115152 7:129110723-129110745 GGCTGTATTGGAACAGAGCCTGG - Intergenic
1032432705 7:131874834-131874856 GGGTTTAGTGGAAGACAAACTGG - Intergenic
1035113379 7:156503752-156503774 GGTGCTATTGGAACATAGCCAGG - Intergenic
1036163277 8:6407940-6407962 AGTTTTATTGGAACACAGGCCGG + Intronic
1036248477 8:7141237-7141259 AGTTTTACTGGAATAAAACCAGG - Intergenic
1036252330 8:7173100-7173122 AGTTTTATTGGAATAAAACCAGG + Intergenic
1036365164 8:8114360-8114382 AGTTTTATTGGAATAAAACCAGG - Intergenic
1036885762 8:12551737-12551759 AGTTTTACTGGAATAAAACCAGG + Intergenic
1036893391 8:12610827-12610849 AGTTTTACTGGAATAAAACCAGG + Intergenic
1037855175 8:22366795-22366817 GGTTTATTTGGAACTCGACCAGG + Intergenic
1038105334 8:24427520-24427542 AGTTTTATTGGAACATAGCCAGG - Intergenic
1039444108 8:37616987-37617009 AGTTTTATTGGAATGCAGCCAGG - Intergenic
1040633886 8:49249436-49249458 GGATAGAATGGAACACAACCTGG - Intergenic
1041033148 8:53758794-53758816 TGTTTTACTGGAACACAGCCAGG + Intronic
1042486268 8:69349501-69349523 AGTTTTTCTGGAACACAGCCAGG + Intergenic
1043264909 8:78253710-78253732 TGTTTTATTGTACCACAAGCTGG + Intergenic
1046721700 8:117627412-117627434 AGTTTTATTGGAACACAACCAGG - Intergenic
1047414025 8:124649156-124649178 AGTTTTATTGAAAGACAGCCAGG + Intronic
1048380230 8:133859253-133859275 GGTTTCATTGGGACACAGCTGGG - Intergenic
1049294271 8:141822460-141822482 GGTTTTATCAGGACAAAACCTGG - Intergenic
1050923428 9:11234326-11234348 TTTTTTATTGCAACACAGCCTGG - Intergenic
1051172845 9:14336949-14336971 AGTTTTATGGAAACACAGCCAGG - Intronic
1056304591 9:85277452-85277474 GGGTTTAGTAGAACTCAACCTGG + Intergenic
1058823172 9:108751595-108751617 AGTTTTATTGGGACACAGCCAGG - Intergenic
1059600807 9:115776329-115776351 GGTTTTCTTGGGAGACAAGCAGG + Intergenic
1060942170 9:127549107-127549129 GTTCTTATTGGAACAGAAGCTGG - Intronic
1185508613 X:646303-646325 GGTTTTCTGGGAACACAGCAAGG + Exonic
1185699426 X:2219152-2219174 GGTTTTATAGGGCCAGAACCAGG - Intergenic
1186127532 X:6430280-6430302 AGTTTTACTGGAACACAGCCAGG - Intergenic
1186498281 X:10030066-10030088 AGTTTTATTGGAACACAGCCAGG - Intronic
1186546411 X:10454495-10454517 AGTTTTATGGGAATACAGCCAGG - Intronic
1187073572 X:15912185-15912207 GGATTTATTGGAACAAAATAAGG - Intergenic
1187109608 X:16283254-16283276 TGGTTTATTGGAAAACAACAAGG + Intergenic
1187483565 X:19680678-19680700 TGTTTTATTAGCATACAACCTGG - Intronic
1187725338 X:22196473-22196495 AGTTTTACTGGAACACAGCCAGG - Intronic
1187751641 X:22472359-22472381 TGTTTTACTGGAACACAGTCAGG + Intergenic
1188557302 X:31427239-31427261 GGTTTTCTAGGAAGAAAACCAGG - Intronic
1189206629 X:39245361-39245383 AGTTTCATTGGAACATAGCCAGG - Intergenic
1194110859 X:89832852-89832874 GGCTTTGTTAGAACACAGCCAGG - Intergenic
1194316452 X:92383087-92383109 AGTTTTATTGGAACACAGGCAGG + Intronic
1194710854 X:97234632-97234654 AGTTTTATTGAAAAACAGCCAGG - Intronic
1195535823 X:106008338-106008360 TGTTTTACAGGAACACACCCTGG + Intergenic
1196754830 X:119148987-119149009 GGTTTCATAGGATCACAACTTGG - Intronic
1197227675 X:123970231-123970253 GGTTTTCTTGGAATACAAAGGGG - Intronic
1198213025 X:134532710-134532732 AGTTTTACTGGCACTCAACCTGG - Intergenic
1199133582 X:144224467-144224489 GCTCTTATTGGCACACTACCAGG - Intergenic
1200463521 Y:3487589-3487611 GGCTTTGTTAGAACACAGCCAGG - Intergenic
1200624627 Y:5496406-5496428 AGTTTTATTGGAACACAGGCAGG + Intronic
1201274925 Y:12287823-12287845 GGTTTTATAGGGCCAGAACCAGG + Intergenic
1201609755 Y:15827776-15827798 AGTTTTATTGGGACACAGCCAGG - Intergenic
1201632197 Y:16081125-16081147 ATTTTTATTGCAACACAGCCTGG + Intergenic
1201902246 Y:19055566-19055588 AGTTTAATTGGAAAACAGCCAGG + Intergenic