ID: 958029979

View in Genome Browser
Species Human (GRCh38)
Location 3:88096975-88096997
Sequence CTTTCTATGCTGATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958029979_958029984 -3 Left 958029979 3:88096975-88096997 CCTTTCCCCATCAGCATAGAAAG 0: 1
1: 0
2: 1
3: 19
4: 166
Right 958029984 3:88096995-88097017 AAGAACACTGGTCATCACATTGG 0: 1
1: 0
2: 2
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958029979 Original CRISPR CTTTCTATGCTGATGGGGAA AGG (reversed) Intronic
901755116 1:11436821-11436843 CTGTCTATGCTGATGTTGAAGGG - Intergenic
901913772 1:12481650-12481672 CTTTCAAGGGGGATGGGGAAAGG + Intronic
902128575 1:14238725-14238747 GTTGCAATCCTGATGGGGAAAGG + Intergenic
904408962 1:30313399-30313421 CTGTCTATGCTAATGGGGCTGGG - Intergenic
905966475 1:42102497-42102519 CTTTCTATGCCGCTGGTGAGTGG + Intergenic
906336991 1:44941556-44941578 CTTGCTATGTTGATGAGAAAAGG - Exonic
910009773 1:82447189-82447211 CTTTCTATACTGAATGGTAAAGG + Intergenic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
910534929 1:88286827-88286849 ATTTTTATGCAGATGTGGAAAGG + Intergenic
910664179 1:89706777-89706799 CTTTCTATGGGGGAGGGGAAGGG - Intronic
910742210 1:90532161-90532183 CTTTCTATGGGGATTGGGTAGGG + Intergenic
912124496 1:106517429-106517451 CTTTCTTTGTTGGTTGGGAAGGG - Intergenic
913390668 1:118307960-118307982 CTGTCTTTGATGATGGGGAAGGG + Intergenic
919988062 1:202689597-202689619 CTTAGTATGCAGATGAGGAAGGG - Intronic
924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG + Intronic
1065455164 10:25899489-25899511 CTTTCCATGCTTGTGGGGGATGG + Intergenic
1067183129 10:44005425-44005447 CTCTAAACGCTGATGGGGAAAGG - Intergenic
1067845970 10:49721589-49721611 CTTTTAATCCTCATGGGGAATGG + Intergenic
1075558498 10:123450206-123450228 CTTTCATTGGTGATGGGCAAGGG + Intergenic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1077872272 11:6271953-6271975 TTTTCAGTGCTGATTGGGAAGGG - Exonic
1079232090 11:18657543-18657565 CTTTATATGGTGATGGGGAAGGG - Intergenic
1080285513 11:30606747-30606769 CTGTCTAGGCTGGTGAGGAAAGG - Intergenic
1082797061 11:57385880-57385902 CTTTATATTCTGGTGTGGAAAGG - Intergenic
1082856946 11:57816744-57816766 ATTTTTTTCCTGATGGGGAAGGG + Exonic
1084046002 11:66568157-66568179 CGATCTCTGGTGATGGGGAATGG - Intronic
1084459658 11:69289504-69289526 CTTGCTTTACTGTTGGGGAACGG + Intergenic
1085692523 11:78675270-78675292 CTTTCTTTGCTGAAGGGCAGGGG + Intronic
1086559122 11:88146870-88146892 CTTTGTACGGTGTTGGGGAAGGG - Intronic
1089913076 11:122123207-122123229 ATTGCAATGGTGATGGGGAAGGG - Intergenic
1090009244 11:123031573-123031595 CTGTGTATGCTGATGGAGAGTGG + Intergenic
1092847847 12:12600610-12600632 CGTTCCATGCTGAGTGGGAAAGG + Intergenic
1093518480 12:20019670-20019692 CTGTCTTTGATGATGGGGAAGGG - Intergenic
1095167041 12:38985282-38985304 CTGTCCATGCTGATGGGTGAGGG + Intergenic
1097238766 12:57558734-57558756 CTTTATGTGCTGATAAGGAAGGG - Intronic
1098102465 12:67032574-67032596 AATTCTTTGTTGATGGGGAAAGG + Intergenic
1099163060 12:79269396-79269418 CTTTCTAAGCTCCTAGGGAAAGG + Intronic
1106340948 13:28825688-28825710 CTTTCTATACTCATGGGGACAGG + Intronic
1108048498 13:46406095-46406117 CACTCTATGCTTATTGGGAAAGG - Intronic
1110270004 13:73578980-73579002 CTCCATATTCTGATGGGGAATGG - Intergenic
1111143651 13:84154538-84154560 CTTTGCATGGGGATGGGGAATGG + Intergenic
1114859888 14:26503809-26503831 CTTTCCATGCTGATAAGTAAAGG - Intronic
1114928293 14:27433417-27433439 CTTTCTTAGCTAATGGAGAAGGG + Intergenic
1117583129 14:57172885-57172907 GTTTCTATGGTGATGGGAGAAGG - Intergenic
1118410546 14:65472517-65472539 TTTTCTATGTTGATGGCCAAAGG + Intronic
1118688226 14:68313042-68313064 CTTTCAAAGTTTATGGGGAAAGG + Intronic
1120713143 14:87814055-87814077 CTTTCCATGCGGATGGTGACAGG + Intergenic
1122365571 14:101193117-101193139 CTTTCCTAGCAGATGGGGAAAGG - Intergenic
1124113594 15:26817450-26817472 CATTGTATGATGATGGTGAAGGG - Intronic
1126776627 15:52105905-52105927 ATTTCCAGGCTGATGGGTAATGG + Intergenic
1130628862 15:85545022-85545044 CTGTCTAGCGTGATGGGGAAAGG - Intronic
1135649371 16:24192610-24192632 GGTTCTATGCTGGTGGGGATGGG - Intronic
1137972358 16:52998676-52998698 CATTCCATGCTCATGGGGATAGG + Intergenic
1141467636 16:84217083-84217105 TTTAATATGCTGCTGGGGAAAGG + Intergenic
1142870092 17:2814475-2814497 CCTTCCATGCCGATGGGGAAGGG - Intronic
1144174403 17:12691066-12691088 CTTTCTTTGTTGATAGCGAATGG + Intronic
1144816333 17:18038256-18038278 CTTTCATTGCTGATGGTGAGTGG - Intronic
1145786472 17:27597175-27597197 CTTCCTTTCCAGATGGGGAAGGG + Intronic
1146694258 17:34896838-34896860 CATTCCAGGTTGATGGGGAAGGG - Intergenic
1147305488 17:39561274-39561296 CTCTCTATTCTGAGGGGTAAGGG + Intronic
1148383184 17:47215353-47215375 CTTTCAGGGCTGATGGGGAGGGG + Intronic
1149208233 17:54273984-54274006 CTTCCTCTGCTGATGGGGCCGGG - Intergenic
1151253709 17:72858597-72858619 CATTCTATGCTTATGGAGATAGG - Intronic
1151877074 17:76872942-76872964 CCTTCTGTGCGGATGGTGAATGG - Exonic
1203169466 17_GL000205v2_random:134911-134933 CTTTCCATACTGGTCGGGAAGGG - Intergenic
1155662457 18:28265880-28265902 CGTACTGTGATGATGGGGAAAGG - Intergenic
1159321857 18:66861474-66861496 TTTTCTATGCTAGTGGGGATTGG + Intergenic
1159820584 18:73137456-73137478 CTTTCTTTACTGAAGGGGAAAGG + Intergenic
1159884708 18:73893011-73893033 CTTTCTATGTTGATGAAAAATGG - Intergenic
1159897514 18:74011436-74011458 CTGTCTCTGCTGATGGAGAATGG + Intergenic
1160032642 18:75276413-75276435 CCTTCTTTCCTGATGAGGAAGGG + Intronic
1160762700 19:793642-793664 CTTTCAGTTCTGATGGGGGAGGG - Intergenic
1165820400 19:38671204-38671226 TTATCTATGGTGATGGGAAAGGG - Intronic
1166140616 19:40803305-40803327 CTTTCTATGTGGTTGGGGACAGG + Intronic
1168651595 19:58095769-58095791 CTTGTAATGCTGAGGGGGAAGGG - Intronic
926249442 2:11145706-11145728 CTTCTTCAGCTGATGGGGAAAGG - Exonic
927148778 2:20184044-20184066 CTTTCCTGGCTGATGGGCAAAGG - Intergenic
928099012 2:28423910-28423932 CATTTAATGCTGATGGGAAAGGG - Intergenic
929593714 2:43162715-43162737 GTATCTATGCAGATGGGGAGGGG - Intergenic
930085694 2:47495560-47495582 TATTCCATGTTGATGGGGAAAGG + Intronic
930092885 2:47544199-47544221 ACGTGTATGCTGATGGGGAATGG - Intronic
931511214 2:62997359-62997381 CTTTCAATGCTGATTGCCAATGG + Intronic
936630622 2:114199018-114199040 CTTTCCAGGCTGAGGGAGAAAGG - Intergenic
940529646 2:154864892-154864914 CTGGCTTTGATGATGGGGAAAGG - Intergenic
940753114 2:157649875-157649897 CTTTCTCTGCTGATCTGGAGAGG - Intergenic
941655368 2:168138013-168138035 CTTTGTTTGTAGATGGGGAAAGG - Intronic
942798713 2:179851340-179851362 CTTTGTAGGCTGAGGTGGAAGGG + Intronic
943569128 2:189551933-189551955 CTTTATATTGTGATGTGGAAGGG - Intergenic
943768695 2:191691814-191691836 TTTCCAATGCTGATGGAGAAAGG - Intronic
944894592 2:204151075-204151097 CTACCTATGCTGATGGGGCGAGG + Intergenic
946622999 2:221578681-221578703 CTTTAGATTATGATGGGGAAAGG - Intergenic
947342741 2:229157023-229157045 CTTTATATTTTGATGAGGAAGGG - Intronic
948727407 2:239943568-239943590 CTTTCTATTCTGTTAGGGACTGG + Intronic
948751275 2:240134778-240134800 CTTACTGTGCTGATGGGGACAGG - Intronic
1171507168 20:25646931-25646953 CTTTCTCAGTTGAAGGGGAAAGG + Intergenic
1172307601 20:33892358-33892380 ATTCCTATCCTGATGGGCAAGGG + Intergenic
1172470654 20:35192031-35192053 CTGACTATTCTGATGGGTAATGG - Intergenic
1173288379 20:41693040-41693062 CTTCACAGGCTGATGGGGAAGGG + Intergenic
1173525046 20:43725615-43725637 CTTTCTGTGCTGATATAGAAAGG - Intergenic
1174432073 20:50477693-50477715 TTCTCTATGCTAATGGAGAAAGG + Intergenic
1174872552 20:54196509-54196531 ATCTCTTTGCTGATGGGGAATGG - Intergenic
1179193179 21:39140692-39140714 TTTTCTCTGCAGATGGGGAAGGG - Intergenic
1179633168 21:42691152-42691174 CTTTGGATGGTGATGGTGAAGGG - Intronic
1179633204 21:42691342-42691364 CTTTGGATGGTGATGGTGAAGGG - Intronic
951483595 3:23187445-23187467 CTTTCTAGGGTAATGAGGAATGG - Intergenic
955062980 3:55509809-55509831 CTTTCTTTGCTGCTGTGGAAAGG - Exonic
955734410 3:62021926-62021948 CTTTCTTTTTTGAGGGGGAAGGG - Intronic
956575971 3:70753189-70753211 GTATGTATGCTGATGAGGAAGGG - Intergenic
958029979 3:88096975-88096997 CTTTCTATGCTGATGGGGAAAGG - Intronic
958653713 3:96974305-96974327 ATTTATATGTTGATGGGGAAGGG + Intronic
960584773 3:119310667-119310689 TTTTCCATGGTGGTGGGGAATGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
963699167 3:148602182-148602204 CTTTTTCTACTGCTGGGGAAAGG - Intergenic
963878949 3:150505615-150505637 CTTAGTGTGCTGATTGGGAAGGG - Intergenic
966759578 3:183405526-183405548 CTTTCTATGATACTGGGAAAAGG - Intronic
966786197 3:183625002-183625024 CTTTCTATGCTAATGGGATATGG - Intergenic
967404938 3:189104894-189104916 TTTTCAAAGCTGATGGGGATGGG - Intronic
967735404 3:192946574-192946596 TTTTCTATGGGGATGGGGATTGG + Intergenic
969296751 4:6274760-6274782 ATTTGTATGCTGATGTTGAAGGG + Intronic
973200820 4:47500202-47500224 ATTTCTACGCTGATGGAGGAGGG + Intronic
974022212 4:56701808-56701830 CTTTCTAAACGGATGGGGGAGGG + Intergenic
974598237 4:64041007-64041029 TTTACTTTGTTGATGGGGAATGG - Intergenic
976281718 4:83333041-83333063 CTTCCTATCCTTAAGGGGAAGGG + Intronic
976384954 4:84446097-84446119 CATTTTATGATGATTGGGAAGGG - Intergenic
978841224 4:113215285-113215307 CCTTCTTTACAGATGGGGAATGG - Intronic
978924362 4:114224905-114224927 TATTCTTTGCTTATGGGGAAGGG - Intergenic
980651110 4:135715994-135716016 GTATCTGTGCTAATGGGGAAAGG - Intergenic
980860076 4:138488500-138488522 GTATCTGTGCAGATGGGGAAAGG - Intergenic
982618246 4:157670073-157670095 CTCTCTTTTCTGATTGGGAATGG + Intergenic
983761987 4:171421725-171421747 CTTTCTTTTTTGATGGGGATAGG - Intergenic
985843810 5:2329670-2329692 CTTTCCAGGCTGGTGGGTAATGG - Intergenic
988291866 5:29297440-29297462 TTTTGTATGCTCATGGGGATGGG - Intergenic
988502823 5:31797951-31797973 TTTTCTATGTTTATGGAGAATGG + Intronic
989119108 5:37985770-37985792 CTGTCTGTGCTGATTGGGACTGG - Intergenic
990966175 5:61450366-61450388 CTTTCCATTCTGCTGGGAAAGGG + Intronic
991027330 5:62044311-62044333 CTTTCTGTGCTGAAAGGGACAGG - Intergenic
992203363 5:74405433-74405455 CTTTCTAACCTGATAAGGAAAGG - Intergenic
992229978 5:74654575-74654597 CTTTCTAGGCAGATGAGGGAAGG + Intronic
995481763 5:112600400-112600422 CTTTCTGGCCTGATGGGGATGGG - Intergenic
995981001 5:118104183-118104205 CTTTATATGCTGAAGGAAAAAGG + Intergenic
996000642 5:118358944-118358966 CTTTCTAAGCAAATGTGGAAAGG + Intergenic
997348242 5:133209614-133209636 CTTTCTTGGCTGATGGGGGAAGG + Intronic
997755635 5:136396492-136396514 CTTTCTACAATGATAGGGAAAGG - Intronic
998003207 5:138640537-138640559 CTTTCTTTACTTATGGGGGAAGG + Intronic
1001061460 5:168493333-168493355 CTTTCTTTGCTGAATTGGAAGGG + Intronic
1002840201 6:898900-898922 CTATCTATGCTGCTAGGGCATGG + Intergenic
1005571402 6:27148814-27148836 CTCTCTATGCCTATGGGGATAGG + Intergenic
1005618837 6:27601629-27601651 CTTTCTTTGGTGATGGGAGAAGG - Intergenic
1006762433 6:36474961-36474983 CTTTCTCTGGTGCTTGGGAATGG - Exonic
1007048660 6:38803407-38803429 CCTTCTTTGCTTCTGGGGAAGGG - Intronic
1007162040 6:39799522-39799544 AGTTCTATTCTGATGGTGAAGGG + Intronic
1007342900 6:41203090-41203112 CTTACTGTTCTGATGGGGGAAGG - Intergenic
1007521520 6:42453985-42454007 CTTTCTTTGCTTATGTGGAAGGG - Intergenic
1009366886 6:62863222-62863244 CTTAATATTCTGAAGGGGAAAGG - Intergenic
1010022833 6:71181109-71181131 ATTTTTATGCTGAGGGGGAAAGG + Intergenic
1010183490 6:73115866-73115888 ATTTCTATGATAATAGGGAAGGG + Intronic
1010187634 6:73161835-73161857 CTTTCTATACTGTTTGGAAAGGG - Intronic
1010294915 6:74184345-74184367 CTTTCTTCCTTGATGGGGAAGGG - Intergenic
1011192664 6:84749120-84749142 CTTTCAAGGCTGATGGGGTAGGG + Intronic
1015018281 6:128440722-128440744 CTTTATATACTGATATGGAAAGG - Intronic
1016094235 6:140016369-140016391 TTTTCTAGGCAGATGTGGAAGGG - Intergenic
1019765628 7:2848009-2848031 CTCTCTACACTGCTGGGGAAAGG + Intergenic
1021526652 7:21595575-21595597 CAATCTATTCAGATGGGGAAGGG + Intronic
1023228692 7:38000659-38000681 CAATCTATGCTGATGGGGGATGG + Intronic
1028240965 7:88420161-88420183 CTTTCTAGGGAGAAGGGGAAAGG + Intergenic
1028370155 7:90082854-90082876 CTTTCTTTTCAGTTGGGGAAGGG - Intergenic
1031458328 7:122012012-122012034 CCCTCTCTGGTGATGGGGAATGG + Exonic
1031791720 7:126114876-126114898 CTGTCAATGCTGAGGGAGAAAGG - Intergenic
1031952699 7:127908723-127908745 TTTTCTATGCTGGTGAGGGAGGG - Intronic
1032639753 7:133752723-133752745 CTTTCTTTTTTGATGGGGTATGG + Intronic
1037706649 8:21321188-21321210 CTATTTATTCTGATTGGGAATGG - Intergenic
1038114708 8:24540460-24540482 TTTTCTGTTCTGATGGGGATTGG + Intergenic
1038418731 8:27418187-27418209 TTTTCTTTCCTAATGGGGAAGGG + Intronic
1045548449 8:103149313-103149335 CTTTCTATGGAGATGGAGATTGG - Intronic
1049445541 8:142628948-142628970 CTTTCTGGGCTGATAGGGAGGGG + Intergenic
1050330403 9:4540093-4540115 CTTTCTCTGCTGTTGGAGACTGG - Intronic
1051003958 9:12319359-12319381 CTTTCGCTGCTGATAGGGCATGG - Intergenic
1055940961 9:81649270-81649292 ATTTCTATGCTGGTGAGAAATGG + Intronic
1056452625 9:86730816-86730838 CTTTCTAAGCAGGTGGGGAAAGG - Intergenic
1056683994 9:88744635-88744657 CTTTCCATGGGGATTGGGAATGG - Intergenic
1058228244 9:102393518-102393540 CTTTGTATGGTTAAGGGGAATGG + Intergenic
1060336933 9:122733517-122733539 CTTTCTAGGGTGATTGTGAATGG - Intergenic
1060966177 9:127713427-127713449 CTTTCCCTGCTGGTGGGGGAGGG - Intronic
1188024834 X:25197348-25197370 CTGCCTATGCTGAGGGAGAAGGG + Intergenic
1193679879 X:84505204-84505226 CTTTTCATTCTGTTGGGGAAAGG - Intergenic
1196129732 X:112142402-112142424 CTTCCTATCCTGATGGTGGAAGG + Intergenic