ID: 958034153

View in Genome Browser
Species Human (GRCh38)
Location 3:88150153-88150175
Sequence CTGAGGCTGCACCAGGCGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958034153_958034161 -3 Left 958034153 3:88150153-88150175 CCAACCGCCTGGTGCAGCCTCAG 0: 1
1: 0
2: 2
3: 35
4: 282
Right 958034161 3:88150173-88150195 CAGGACCGCCAAGGTAAGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 85
958034153_958034164 14 Left 958034153 3:88150153-88150175 CCAACCGCCTGGTGCAGCCTCAG 0: 1
1: 0
2: 2
3: 35
4: 282
Right 958034164 3:88150190-88150212 GGGCGGACCCTTCACCTAGAAGG 0: 1
1: 0
2: 0
3: 3
4: 39
958034153_958034160 -6 Left 958034153 3:88150153-88150175 CCAACCGCCTGGTGCAGCCTCAG 0: 1
1: 0
2: 2
3: 35
4: 282
Right 958034160 3:88150170-88150192 CCTCAGGACCGCCAAGGTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 83
958034153_958034158 -7 Left 958034153 3:88150153-88150175 CCAACCGCCTGGTGCAGCCTCAG 0: 1
1: 0
2: 2
3: 35
4: 282
Right 958034158 3:88150169-88150191 GCCTCAGGACCGCCAAGGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958034153 Original CRISPR CTGAGGCTGCACCAGGCGGT TGG (reversed) Exonic