ID: 958034298

View in Genome Browser
Species Human (GRCh38)
Location 3:88151553-88151575
Sequence CTTGTTAGAAGCAGAATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958034298_958034302 22 Left 958034298 3:88151553-88151575 CCAGAAATTCTGCTTCTAACAAG 0: 1
1: 0
2: 4
3: 45
4: 370
Right 958034302 3:88151598-88151620 CTTGCCCCTTTTTGAGCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 150
958034298_958034301 21 Left 958034298 3:88151553-88151575 CCAGAAATTCTGCTTCTAACAAG 0: 1
1: 0
2: 4
3: 45
4: 370
Right 958034301 3:88151597-88151619 GCTTGCCCCTTTTTGAGCACTGG 0: 1
1: 0
2: 1
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958034298 Original CRISPR CTTGTTAGAAGCAGAATTTC TGG (reversed) Intronic
901113159 1:6815793-6815815 CTTGTTAGAGGCAGAATCTCAGG + Intronic
903646403 1:24898703-24898725 CTTGTTGGGAGCTGAGTTTCAGG + Intergenic
903726774 1:25453360-25453382 ATTCTTAGAAGTGGAATTTCTGG + Intronic
904855177 1:33492472-33492494 TTTGTTAAAAGGAGAATTTATGG + Intronic
905018928 1:34795181-34795203 CTTCTTAGAAGCAGAGCTGCTGG - Exonic
905577716 1:39059048-39059070 CTGCCTAGAAGCAGAAGTTCTGG + Intergenic
906337991 1:44951380-44951402 CCTGTTAGAATCAGAATTGCTGG - Intronic
907607355 1:55831373-55831395 CTTTTTAGAAACAGATTTTGGGG + Intergenic
907716235 1:56928780-56928802 CATGTTGGAAGCAGGAGTTCTGG - Intergenic
908766260 1:67557602-67557624 CTTAATAGAAGTAGAATATCTGG + Intergenic
910477281 1:87620624-87620646 ATTCCTAGAAGTAGAATTTCTGG - Intergenic
910558620 1:88565551-88565573 CTTGTTAGAAGCACATTTGGGGG + Intergenic
910975760 1:92903577-92903599 CTTCTAAAATGCAGAATTTCAGG + Intronic
911162226 1:94692623-94692645 TATTCTAGAAGCAGAATTTCTGG - Intergenic
912350610 1:109008916-109008938 CTAATTAGAAACAGAAATTCTGG + Intronic
913077131 1:115350155-115350177 CTTCTTAGAAGAAGAGATTCAGG + Intergenic
913393493 1:118340682-118340704 TTTGTTAGATGCAAAATTTCAGG + Intergenic
914882942 1:151561710-151561732 GTTGTCAGGAGCAGAAATTCTGG + Intronic
915995259 1:160555887-160555909 ATTGTTAGGACCAGAATTTCTGG - Intronic
916563717 1:165955180-165955202 GTGGTTAGCAGCTGAATTTCTGG + Intergenic
916607402 1:166356913-166356935 ATTCTTAGAAGTAGAACTTCTGG + Intergenic
916968337 1:169978807-169978829 CATTTTAGAAACAGAGTTTCAGG + Intronic
917755778 1:178095930-178095952 CTGGTTATAAGAAGAATTCCTGG - Intronic
918917378 1:190660914-190660936 CATGTTAGAAGCAGAAAGTTAGG - Intergenic
919013870 1:192003401-192003423 TTTCTTAGAAGAAGAATTTATGG - Intergenic
919436540 1:197569403-197569425 ATTCCTAGAAGCAGAATTGCTGG - Intronic
919687994 1:200502308-200502330 CTTTTTAAAAACGGAATTTCTGG + Intergenic
919846339 1:201644748-201644770 CTCAAAAGAAGCAGAATTTCAGG + Intronic
919894165 1:201998200-201998222 ATTCTTAGAAACATAATTTCTGG + Intronic
920332655 1:205221586-205221608 CCTGATAGAAACCGAATTTCTGG - Intergenic
920881886 1:209888324-209888346 CTTCTTAAAAGCAGCATGTCTGG + Intergenic
921248308 1:213271059-213271081 ATTGCTAGAAGCAGAATTGCTGG - Intronic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
922031589 1:221805865-221805887 ATTATTAGAAGTAGAATTGCTGG - Intergenic
922372565 1:224926001-224926023 CTTGTTTGAAGCAGAATCGGGGG - Intronic
923171051 1:231417776-231417798 CATGTTTGAAGTAGAAATTCAGG + Intronic
924930082 1:248722862-248722884 CTTGAAAGATACAGAATTTCAGG + Intronic
1063220871 10:3966505-3966527 ATTCTTAGAAGCAGGATTTGAGG - Intergenic
1063755766 10:9005970-9005992 CATGTAATAAGCAGAATTTATGG - Intergenic
1064551821 10:16508971-16508993 GGTGTTAGACACAGAATTTCTGG - Intronic
1064874457 10:19977300-19977322 ATTGTTAGATGCAGAATCTCTGG + Intronic
1065919293 10:30377596-30377618 ATTCATAGAAGTAGAATTTCTGG - Intergenic
1069038914 10:63673853-63673875 ATTCTTAGAAGCAGACTTTCTGG - Intergenic
1069224268 10:65922255-65922277 CTTCTTAAAAGCAGAGTTGCTGG - Intronic
1069672509 10:70220228-70220250 CTTTTTATAAGCATAATTGCAGG - Intronic
1070525011 10:77288675-77288697 GTAGTTAAAAGCAGCATTTCTGG - Intronic
1070553229 10:77507846-77507868 ATTCCTAGAAGCAGAATTGCTGG - Intronic
1070959569 10:80489211-80489233 CTTCTGAGAAGCAGAATCTGCGG - Exonic
1072417527 10:95261564-95261586 CTTGCAAGAACCAGAATTTGAGG + Intronic
1073270370 10:102257893-102257915 CTTGTTAAAAACAATATTTCTGG - Intronic
1073713486 10:106073475-106073497 CTTAGTAGAATCAGAATTTAAGG + Intergenic
1074608854 10:115001960-115001982 ATTGTTACAAGCAGAACATCTGG - Intergenic
1075978701 10:126719056-126719078 CTCCTTGGAATCAGAATTTCTGG - Intergenic
1077477943 11:2799740-2799762 TTTGCCAGGAGCAGAATTTCTGG + Intronic
1077832701 11:5892154-5892176 CTTATTTGAAGTAGAATTTTTGG - Intronic
1078977256 11:16493090-16493112 ATTCTTAGAAGTAGAATTTCTGG - Intronic
1080068835 11:28054043-28054065 ATTCTTAGAAGTAAAATTTCTGG - Intronic
1080146416 11:28989971-28989993 TTTCTTAGAAGTAGAAGTTCTGG + Intergenic
1080308180 11:30859429-30859451 GTAGTTATAAGCAGAGTTTCTGG - Intronic
1080332057 11:31150166-31150188 ATTTTTAGAAGTGGAATTTCTGG - Intronic
1080809824 11:35692621-35692643 ATTGTTAGAAGAAAAACTTCAGG + Intronic
1082176463 11:49065934-49065956 CTCGTTAGAATCAGAAGATCTGG + Intergenic
1083073874 11:60017158-60017180 CTTGTTAGACGCAAAATAACAGG - Intergenic
1084915758 11:72427988-72428010 CTTGCTAGAAGGAAACTTTCTGG - Intronic
1086062397 11:82713314-82713336 CTTGTTAGAAGACAAATTGCTGG + Intergenic
1086689251 11:89769941-89769963 CTTGTTAGAATCAGAAGATCTGG - Intergenic
1086716607 11:90070030-90070052 CTTGTTAGAATCAGAAGATCTGG + Intergenic
1086909433 11:92455327-92455349 CTTGTCAGAGCCACAATTTCTGG - Intronic
1087044388 11:93832028-93832050 ATTATTAGAAGTGGAATTTCTGG - Intronic
1087746914 11:101958004-101958026 CATGTTAGAATGAGAATTTAAGG - Intronic
1088319311 11:108538814-108538836 CTCGTTAGAAGTTGGATTTCAGG + Intronic
1088591311 11:111405660-111405682 CATTTTATAAGCATAATTTCAGG - Intronic
1089110825 11:116054643-116054665 CTTCTTAAAGGCTGAATTTCTGG - Intergenic
1089440385 11:118511101-118511123 GTGAATAGAAGCAGAATTTCAGG + Intronic
1091544542 12:1492634-1492656 CTTCTGAGAAGAAGCATTTCCGG + Exonic
1092815636 12:12310281-12310303 CCTGATTGAACCAGAATTTCAGG + Intergenic
1093657595 12:21714275-21714297 CATTTGAGAAGCAGAATTTATGG - Intronic
1094445968 12:30530793-30530815 ATTCCTAGAAGCAGAATTCCTGG + Intergenic
1095189189 12:39236265-39236287 CTTTTTAGAAACAGATTCTCAGG - Intergenic
1095453643 12:42358859-42358881 GTTACTAGAAGCAGAATTTCTGG + Intronic
1095663926 12:44772434-44772456 CTTTTCAGAAGCACATTTTCTGG + Intronic
1095939610 12:47717392-47717414 CTTGTTAGAAACACAAACTCTGG - Intronic
1095988867 12:48019949-48019971 TTTCCTAGAAGCAGAATTGCTGG + Exonic
1096192510 12:49629578-49629600 CTTGTTGGAAGCTGTATTCCTGG - Intronic
1096232910 12:49906750-49906772 CTTGTTACAGTCTGAATTTCTGG + Intergenic
1096324276 12:50645256-50645278 ATTCCTAGAAGTAGAATTTCTGG - Intronic
1096471260 12:51877848-51877870 ATTTCTAAAAGCAGAATTTCTGG + Intergenic
1098012341 12:66066856-66066878 CTTCACAGAAGCAGAAATTCAGG + Intergenic
1100661491 12:96703860-96703882 ATTCCTGGAAGCAGAATTTCTGG - Intronic
1100743764 12:97623228-97623250 CTGGTTGGAAGCAGCTTTTCAGG - Intergenic
1100982878 12:100176352-100176374 TTTCATAGAAGTAGAATTTCTGG - Intergenic
1101384838 12:104247527-104247549 TTTGTTAGAGGCAGAATTTAAGG + Intronic
1101860648 12:108479755-108479777 CTGGCTAGAAAGAGAATTTCAGG - Intergenic
1102936456 12:116901283-116901305 ATTGCTAGGAGCAGAATTGCTGG - Intergenic
1103423971 12:120815042-120815064 CTTGTTAACAGCAGAGTTTTTGG - Intronic
1105926323 13:25011962-25011984 CTTGTTAAAGGCAGATTCTCAGG - Intergenic
1106759869 13:32858005-32858027 CTTGTTAGAAGTGGGATTTCTGG + Intergenic
1108366115 13:49715772-49715794 ATTCTTAGAAGCAGGATTGCTGG - Intronic
1109156598 13:58918663-58918685 ATCGTTAGAGGCAGAATTGCAGG - Intergenic
1109365302 13:61347994-61348016 CTGTTTAGAAGTAGAATTTCTGG + Intergenic
1109414258 13:62015517-62015539 CTGTATAGAAGCAGAATTTGGGG - Intergenic
1109651158 13:65328610-65328632 TTTATTAGAAGCATAATTTGGGG + Intergenic
1110736143 13:78939015-78939037 CTGGTTGGAAGGAAAATTTCAGG + Intergenic
1110853682 13:80274143-80274165 CTTCCTAGGAGCAGATTTTCAGG + Intergenic
1111261277 13:85743915-85743937 CTTGTAAGAAGAAAAATTGCTGG - Intergenic
1111365664 13:87240544-87240566 ATTGATAGAAGCAGCATTTATGG - Intergenic
1112303700 13:98253839-98253861 CTGGGTGGAGGCAGAATTTCTGG + Intronic
1112359606 13:98705562-98705584 CTAGTTAAATGCAGCATTTCAGG + Intronic
1112475409 13:99727238-99727260 CTTGTTTGAAGCCTAATTGCAGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114273096 14:21116370-21116392 ATTCTTAGAAGCAGAATGGCTGG - Intergenic
1114441936 14:22755594-22755616 CTTGTAAGAAGGAGAAATTTAGG + Intergenic
1116438158 14:44918402-44918424 CTTTTTAGAAGTGGAATTGCTGG - Intergenic
1118970898 14:70636738-70636760 CTTGTTAGAAACATAATCTTGGG + Intergenic
1119437233 14:74605475-74605497 CTTGTCAGACCCAGAGTTTCCGG + Intronic
1119483188 14:74972676-74972698 ATTCCTAGAAGTAGAATTTCTGG + Intergenic
1119554762 14:75544657-75544679 CTTGTTAAGAATAGAATTTCAGG - Intronic
1120195105 14:81472746-81472768 CTTGTAAAAATCTGAATTTCAGG + Exonic
1120780996 14:88485389-88485411 CTTTTTAGATGCAGATTTTCTGG - Intronic
1122039313 14:98972208-98972230 ATTTCTAGCAGCAGAATTTCTGG - Intergenic
1123195653 14:106613848-106613870 ATTTCTAAAAGCAGAATTTCTGG - Intergenic
1123504743 15:20929721-20929743 TTTATTACAAGCAAAATTTCAGG + Intergenic
1123561990 15:21503422-21503444 TTTATTACAAGCAAAATTTCAGG + Intergenic
1123598234 15:21940703-21940725 TTTATTACAAGCAAAATTTCAGG + Intergenic
1124562513 15:30788312-30788334 ATTCATAGAAGTAGAATTTCTGG + Intergenic
1125451614 15:39813897-39813919 ATTACTAGAAGCAGAATTTCTGG + Intronic
1126216860 15:46165431-46165453 TTTATTAGAAGGATAATTTCAGG + Intergenic
1127505506 15:59594062-59594084 ATTATTAGAAGTATAATTTCTGG - Intergenic
1127777231 15:62274102-62274124 ATTCATAGAAGTAGAATTTCTGG - Intergenic
1129474098 15:75772406-75772428 ATTCATAGAAGTAGAATTTCTGG + Intergenic
1129773419 15:78217397-78217419 CTTGTTAGGAGCATAAACTCTGG - Intronic
1129837274 15:78718024-78718046 ATTCATAGAAGTAGAATTTCTGG + Intronic
1130268014 15:82426767-82426789 ATTCATAGAAGTAGAATTTCTGG + Intergenic
1130483607 15:84384117-84384139 ATTCATAGAAGTAGAATTTCTGG + Intergenic
1130504010 15:84520067-84520089 ATTCATAGAAGTAGAATTTCTGG - Intergenic
1130509374 15:84575777-84575799 ATTCATAGAAGTAGAATTTCTGG - Intergenic
1131187671 15:90289052-90289074 ATTTATAGAAGTAGAATTTCTGG + Intronic
1131283137 15:91036955-91036977 ATTCATAGAAGAAGAATTTCTGG - Intergenic
1131320554 15:91385991-91386013 CTTGTCAGAAACAGGATTTAAGG - Intergenic
1131455128 15:92577456-92577478 ATTTTTAGAAGCAGAATTTCTGG - Intergenic
1131619245 15:94049506-94049528 CTTTTTATAAGCAGATTTTGGGG - Intergenic
1132067709 15:98745876-98745898 ATTCCTAGAAGTAGAATTTCTGG - Intronic
1202970335 15_KI270727v1_random:230548-230570 TTTATTATAAGCAAAATTTCAGG + Intergenic
1134005966 16:10818968-10818990 CTTGTGAAAAGCAGATTCTCAGG + Intergenic
1134006033 16:10819171-10819193 CTTGTGAAAAGCAGATTCTCAGG - Intergenic
1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG + Intronic
1135833602 16:25801431-25801453 CTTCTTAGAAGTGGAATTTCTGG + Intronic
1138127464 16:54450769-54450791 ATTCTTAGAAGCAGAATTGCTGG + Intergenic
1139263313 16:65616508-65616530 CTTGAAAGATGCAGAACTTCAGG + Intergenic
1140442139 16:74996328-74996350 CTAGGTAGGAGCAGAATTGCTGG + Intronic
1140539693 16:75745275-75745297 CTTGTTAAAAGAAAAACTTCAGG + Intronic
1141262913 16:82470003-82470025 CTGGGTAGAAGCAGAATCACAGG + Intergenic
1143589240 17:7871025-7871047 CTTTTTAGAAAAATAATTTCTGG - Intronic
1143683411 17:8494397-8494419 GTTGTGTGGAGCAGAATTTCTGG + Intronic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1144286669 17:13782126-13782148 ATGATTAGAAGCAGAATTTTTGG - Intergenic
1145839121 17:27978805-27978827 ATTCTTGGAAGCGGAATTTCTGG - Intergenic
1146660425 17:34661919-34661941 CCTGTTCAAAGCAGAATTCCAGG - Intergenic
1146801557 17:35827798-35827820 CTGGCTAGAAGAAGAATTCCCGG + Intronic
1147506785 17:41026171-41026193 CTTCTTAGAAGCTGAATGTTGGG + Exonic
1147795820 17:43042045-43042067 CTTGTTACAGGCAGAGTTACAGG + Intergenic
1149501056 17:57152802-57152824 CTTGTTAGAATCAGACACTCTGG + Intergenic
1149590291 17:57824114-57824136 CTTGTTTGAATCAAAATTCCTGG + Intergenic
1149594925 17:57859492-57859514 CTTGTTAGAAAAAGAATCTCAGG - Intergenic
1150198226 17:63324101-63324123 CTTTTTTGAAGAAGAATTTTAGG - Intronic
1150754960 17:67903217-67903239 CTTGTGAGAATCAGAAATACTGG + Intronic
1153516441 18:5907094-5907116 AGTCTTAGAAGGAGAATTTCTGG + Intergenic
1153733948 18:8044983-8045005 CTAGCTAGAAGTAGAATTACTGG - Intronic
1153991069 18:10401093-10401115 ATTCTTAGAAGTGGAATTTCTGG - Intergenic
1155401428 18:25443620-25443642 CTTGCTAGAACCAGGGTTTCAGG + Intergenic
1155759314 18:29545647-29545669 CTTGATAGAATTAGAATATCTGG + Intergenic
1155991223 18:32281487-32281509 CTTGTGAGAAACAGAGTTTAGGG - Intronic
1156903138 18:42324619-42324641 ATTTCTAGAAGCAGAAGTTCAGG + Intergenic
1157232143 18:45927437-45927459 CATGTGAGAAGTAGAATTGCTGG - Intronic
1163805563 19:19394922-19394944 GGTGTTAGAAGGAGAGTTTCTGG + Intronic
1164499420 19:28803127-28803149 TTTGTTAGATGCATAATTTGAGG - Intergenic
1164728963 19:30487158-30487180 ATTCTCAGAAGCAGAATTACTGG - Intronic
1165235024 19:34413826-34413848 CTTGTCAGGAGCAGATTTTGAGG + Exonic
1165895197 19:39137096-39137118 TGTGTTAGGAGCAGAACTTCAGG - Intronic
926643054 2:15258460-15258482 CTTGCTAGGAGAAGAATTTAGGG - Intronic
927338793 2:21956309-21956331 CTTTTAAGAAGCAGAATTAGAGG - Intergenic
928156825 2:28884394-28884416 ATACTTAGAAGCAGAATTGCTGG + Intergenic
928196785 2:29221964-29221986 CATATTAGAAGCACAATTACTGG + Intronic
929184126 2:39075406-39075428 CTTGATAAAAAAAGAATTTCAGG - Intronic
930129842 2:47838415-47838437 CTTTTCAGAAGTAGAATTACTGG + Intronic
930672198 2:54163109-54163131 TTTGTTAGAGGCAGAATATCAGG - Intronic
930950770 2:57142014-57142036 ATTTTTAGAATCAGAATTTCTGG - Intergenic
931700583 2:64905709-64905731 CTTTATGGAAACAGAATTTCTGG - Intergenic
932136633 2:69236620-69236642 ATTGTTTGAGGTAGAATTTCTGG - Intronic
932265508 2:70364194-70364216 CTTGTTAGAAACAGAATCTTGGG - Intergenic
932373998 2:71218623-71218645 ATTCATAGAAGTAGAATTTCTGG - Intronic
932535565 2:72590468-72590490 GTTGTTATATGTAGAATTTCTGG - Intronic
932537452 2:72614650-72614672 CTTGTTTTAAGCAGAAGTGCTGG - Intronic
935006093 2:99078331-99078353 CTTCTTAAAAGCATATTTTCAGG - Intronic
935076029 2:99744896-99744918 ATACTTAGGAGCAGAATTTCTGG + Intronic
936274060 2:111077579-111077601 ATTGTTAAAAGCAGTTTTTCAGG - Intronic
938157051 2:128950692-128950714 TTGGTTAGGAGCAGAAATTCTGG + Intergenic
938215328 2:129507820-129507842 CTTGTAAGAGGCAAAATTCCAGG + Intergenic
939602959 2:144216629-144216651 GTTGACAGAAGCAGAATTTATGG + Intronic
940278416 2:151963709-151963731 CTTCTTAGAAGCAAAATTACTGG - Intronic
940420468 2:153475381-153475403 CTTGTTTCATGCACAATTTCTGG + Intergenic
940712404 2:157178242-157178264 CTTATTAAAAGTAAAATTTCTGG + Intergenic
941446377 2:165605305-165605327 ATTGTTCCAAGCAGAATTTTAGG - Intronic
941628360 2:167855778-167855800 TTTGGTAGAAGTAGAATTTAGGG - Intergenic
942267057 2:174238696-174238718 ATATTTAGAAGTAGAATTTCTGG - Intronic
942512301 2:176715420-176715442 CTGGTTAGAATCAGAGTTCCTGG + Intergenic
942663122 2:178287615-178287637 CTTTTTTGAAGGGGAATTTCAGG + Intronic
942791756 2:179768862-179768884 CTGGATAGAAGCAGAAGCTCAGG - Intronic
944253826 2:197604253-197604275 GTTTCTAGAAGCAGAATTGCTGG - Intronic
944912764 2:204326624-204326646 CTTGTTAGAAACAGTCTCTCAGG - Intergenic
944914868 2:204348618-204348640 AATCTTAGAAGTAGAATTTCTGG + Intergenic
945471532 2:210233292-210233314 TATGTTAGAAGCAGAATCACTGG - Intergenic
945600512 2:211857376-211857398 ACTTTTAGGAGCAGAATTTCAGG - Intronic
945765492 2:213971666-213971688 ATTTTTAGAAGCAGAGTTGCTGG - Intronic
946614524 2:221495423-221495445 CTTGTCAGAAACAGACTCTCAGG + Intronic
946815214 2:223570044-223570066 CTTGTTAGTAACCTAATTTCAGG - Intergenic
948469787 2:238169822-238169844 CACGTGGGAAGCAGAATTTCCGG + Intergenic
948780929 2:240321138-240321160 ATTGTTAGATGTGGAATTTCTGG - Intergenic
948841923 2:240655485-240655507 CCTGTTAGAAGCAGGAGTGCAGG + Intergenic
1172014880 20:31867397-31867419 ATTCCTAGAAGCAGAATTGCTGG - Intronic
1172919679 20:38471098-38471120 CCACTTAGAAGCAGAATTTCAGG + Intergenic
1173247040 20:41344129-41344151 CTTGTTAGAAACAGAAACTTAGG - Intronic
1173344943 20:42190669-42190691 CTTGTTACAAGCAAATTCTCAGG - Intronic
1173828259 20:46061283-46061305 ATTGTTAGAAGGAGGGTTTCTGG - Exonic
1174496338 20:50946678-50946700 CTTGTTAGGAGCAGGACTTGGGG + Intronic
1175031727 20:55961446-55961468 CTTGTTGGATGCAGAATTATTGG - Intergenic
1175109743 20:56639267-56639289 CTTGTTAGAATCTGAAAGTCTGG + Exonic
1175619604 20:60432232-60432254 ATAACTAGAAGCAGAATTTCTGG - Intergenic
1176727574 21:10453126-10453148 CCTGTTTGAAGCAGCATTTTTGG + Intergenic
1177555618 21:22684058-22684080 CTTGTTAGAATCTGAAGTTGGGG - Intergenic
1180016280 21:45087192-45087214 ATTCCTAGAAGCAGAATTGCTGG - Intronic
1180244415 21:46537517-46537539 CTTTATAGAAGCACACTTTCTGG - Exonic
1180286820 22:10753905-10753927 CCTGTTTGAAGCAGCATTTTTGG - Intergenic
1180568720 22:16696986-16697008 CTTATCAGAGGCAGGATTTCTGG + Intergenic
1182102306 22:27666710-27666732 CATGGCAGCAGCAGAATTTCAGG + Intergenic
1184750044 22:46480202-46480224 ATTGTGGGAAGCAGAATTACTGG - Intronic
949985193 3:9535422-9535444 CTGGTTAGAAGCAGGCTGTCTGG - Intronic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
951155258 3:19344899-19344921 CTTATTAGAAGCAGCAGTTGTGG + Intronic
951360601 3:21720258-21720280 CTTGTTAGAAATACAAATTCTGG + Intronic
953612766 3:44461280-44461302 CTGGTTAGAAGGAGCACTTCAGG - Intronic
954701611 3:52453575-52453597 CATGTGAGAAGCAGAATGTGAGG + Intronic
956216782 3:66857795-66857817 TTTGTTGGAAACACAATTTCAGG - Intergenic
957641409 3:82858365-82858387 CTAGTTAGAAGTGGAATTTATGG + Intergenic
958034298 3:88151553-88151575 CTTGTTAGAAGCAGAATTTCTGG - Intronic
958874187 3:99597052-99597074 TTTCTAAGAAGGAGAATTTCTGG + Intergenic
959149799 3:102594944-102594966 CATATTAGAAGAATAATTTCAGG - Intergenic
960132766 3:114075048-114075070 ATTGTTAGAAGTGGAATTTTAGG + Intronic
961023589 3:123531497-123531519 TTTGTTAGAGGCGGAGTTTCAGG + Intronic
961863891 3:129939630-129939652 CTGCCTAGAAGCAGAATTTCTGG + Intergenic
963001949 3:140689502-140689524 TTTGTGAGAACCAGAATCTCAGG - Intronic
964086868 3:152829373-152829395 CTTGTTATAAGAAGACTGTCTGG + Intergenic
964234135 3:154505656-154505678 CTTCTTTGAAGCTGAATTTTTGG + Intergenic
964723305 3:159789561-159789583 CTTGTTTGAAACACAATTGCTGG + Intronic
966090742 3:176132878-176132900 CATTCTAGAAGCAGAATATCAGG + Intergenic
966246167 3:177809579-177809601 CTTATTAAAAGGAAAATTTCAGG + Intergenic
969430748 4:7152646-7152668 TTTTCTAGAAGCAGAATTTCTGG + Intergenic
970104180 4:12561583-12561605 CTTATTAGAAGTAGAAGTTTTGG - Intergenic
970384121 4:15538896-15538918 CTTGTTAGAAACATAAACTCAGG + Intronic
970498250 4:16650097-16650119 AGTGTTAGAAGAAGAATCTCTGG + Intronic
970762374 4:19506581-19506603 CTTTTTAAAAGAAGAATTTTAGG + Intergenic
971976949 4:33702133-33702155 ATAGTCAGAAGTAGAATTTCTGG + Intergenic
972702947 4:41511473-41511495 CTTGTTTGAAGGAGAAATTTTGG + Intronic
974689899 4:65284352-65284374 CTTGTTGGAAGTACAAATTCTGG - Intergenic
975344272 4:73276350-73276372 GTCATTAGAAGAAGAATTTCTGG + Intergenic
976816383 4:89152106-89152128 CTTGTTAGAGGCATAATAGCAGG + Intergenic
977637669 4:99318255-99318277 CATTTTAGAAACACAATTTCAGG - Intronic
978879512 4:113684727-113684749 TTTCTGAGAAGTAGAATTTCAGG - Intronic
979386899 4:120077347-120077369 CTTCTTAGAAGCAGACTATCTGG + Intergenic
980309701 4:131110489-131110511 CATGCTGAAAGCAGAATTTCTGG - Intergenic
980588065 4:134846050-134846072 CTTGCAAGTAGCAGAGTTTCTGG + Intergenic
981730418 4:147891107-147891129 ATAGCTAGGAGCAGAATTTCTGG - Intronic
982367223 4:154592657-154592679 CATGTAGGAAGCAGAATTTGAGG - Intergenic
982986141 4:162209338-162209360 GTTCTTAGAGGCAGAATCTCTGG - Intergenic
984182339 4:176499097-176499119 CGTGTTAAAAGCACATTTTCTGG + Intergenic
984688826 4:182702186-182702208 CTGGTTAGATGCACAATTCCTGG - Intronic
984887749 4:184465851-184465873 GTTCCAAGAAGCAGAATTTCTGG + Intronic
985816009 5:2128575-2128597 GTTTTTAGAAGCAGAATTTTGGG + Intergenic
985944722 5:3169765-3169787 ATTATTAGAAACAGAACTTCTGG + Intergenic
986728181 5:10615313-10615335 ATTGTTAGAAGCAGGATTTCTGG - Intronic
987041101 5:14063498-14063520 ATGTATAGAAGCAGAATTTCTGG - Intergenic
989034029 5:37150835-37150857 CTACTTAAAATCAGAATTTCAGG + Intronic
989581244 5:43034968-43034990 CTTGTTAAACTCATAATTTCTGG + Intergenic
989738562 5:44740132-44740154 GCTGTTTGAGGCAGAATTTCTGG - Intergenic
990158388 5:52906252-52906274 CTTATTAGAAGATGAAATTCGGG + Intronic
990789446 5:59460622-59460644 CTTCTTGGAAGCTGTATTTCAGG - Intronic
992223786 5:74598675-74598697 CTTTTTAGAAGCAAAATTCTTGG - Intergenic
992925338 5:81579038-81579060 CTTGATAAAAGCAGAGTTTAGGG + Intronic
993561905 5:89420170-89420192 CTTGTTAGAACAACAACTTCTGG + Intergenic
994924041 5:106090409-106090431 CATAATAGAAGCAGAATGTCTGG - Intergenic
994927780 5:106140802-106140824 CTTGTTTGAATCAGAAAATCTGG - Intergenic
996855834 5:128005506-128005528 CTTGTTAGAAATATAAATTCTGG + Intergenic
997819566 5:137052512-137052534 ATTTTTAGAAGTAGAATTTCTGG - Intronic
997854105 5:137357997-137358019 CTTGTCAGAAGGCAAATTTCTGG - Intronic
998491989 5:142555120-142555142 CTTGTTAGAAGAGGAAATTTGGG - Intergenic
1000148593 5:158477645-158477667 CTATTTGGAAGCAGAAATTCAGG - Intergenic
1000848165 5:166306907-166306929 CTTTTTAGAATCAGCATCTCTGG + Intergenic
1001845830 5:174920258-174920280 ATTCATAGAAGTAGAATTTCTGG - Intergenic
1001866615 5:175111587-175111609 CTTGTTAGAAACAGGACCTCGGG + Intergenic
1003861995 6:10330858-10330880 GTTCCTAGAAGTAGAATTTCTGG - Intergenic
1004810689 6:19258083-19258105 CTTGTTTGAAGAAAAATTTGAGG - Intergenic
1005669554 6:28091265-28091287 ATGGTTAGGAGCAGGATTTCGGG + Intergenic
1005746298 6:28841303-28841325 CTTTTTAGAAGTGGAATTTGTGG - Intergenic
1006129009 6:31857561-31857583 CCTGTTAGAAACAGAAGTGCTGG - Intergenic
1007331567 6:41114499-41114521 CTTGCTAATAGCTGAATTTCTGG + Intergenic
1008245971 6:49173482-49173504 CTTGTTAAATGCAGATTTCCAGG - Intergenic
1009458531 6:63885679-63885701 CTTACTAGAAGCAGAATCTGGGG + Intronic
1009665819 6:66677857-66677879 GTTATTAGAAGCAAAATATCTGG + Intergenic
1010387594 6:75300210-75300232 CTTGTTATAAGTTGAATTTCTGG - Intronic
1011133446 6:84074905-84074927 CATGCTAGAATGAGAATTTCTGG + Intronic
1011457112 6:87563033-87563055 CTTGTTACAAGGTGAATTTGAGG - Intronic
1011537999 6:88398248-88398270 CTTGTTAGAAGGAAAATTTATGG - Intergenic
1011571651 6:88743803-88743825 ATTTTCAGAAGCAGAATTGCTGG + Intronic
1012109275 6:95205754-95205776 CTCATTAGAAGTAAAATTTCTGG - Intergenic
1012213321 6:96551164-96551186 CTTGTGAGAAACAGAATATTTGG - Intronic
1013976387 6:116083658-116083680 CTTGTTAGAAACAAATTTTTGGG - Intergenic
1015579907 6:134713176-134713198 CTACTTAGTAGCAGTATTTCTGG + Intergenic
1015925554 6:138307192-138307214 CTTAAAAGGAGCAGAATTTCTGG - Intronic
1016257972 6:142131979-142132001 CTTCTCAGAATCAGAATTTCAGG - Intergenic
1016338995 6:143040671-143040693 ATTGTTGGAAGCAGAAGTTCTGG + Intergenic
1016919291 6:149274977-149274999 TATGTTAGAAACAGAATGTCTGG + Intronic
1019204355 6:170346835-170346857 CTTCTTAGAAACATACTTTCAGG - Intronic
1019627031 7:2021421-2021443 CTTGCTGGATGCAGAATTCCAGG - Intronic
1020386352 7:7607373-7607395 CACTCTAGAAGCAGAATTTCTGG + Exonic
1021226363 7:18031988-18032010 CTTGTTAGAAACACAAACTCTGG - Intergenic
1021629075 7:22625839-22625861 ATTGGTAGAAGTAGAATTGCTGG + Intronic
1021664647 7:22963778-22963800 CTTCTTAAAGGCAGAATTTATGG - Intronic
1021811849 7:24409893-24409915 CTTGTTAGAAACGGATGTTCAGG - Intergenic
1022452672 7:30529472-30529494 ATTCATAGAAGTAGAATTTCTGG - Intronic
1022706217 7:32804440-32804462 ATTCCTAGAAGCAGAATTGCTGG - Intergenic
1023203548 7:37723869-37723891 TTTCTTTGAAGCAAAATTTCTGG + Intronic
1025243269 7:57295808-57295830 CTGGGTAGAAGCAGGATTGCTGG + Intergenic
1026601377 7:71780341-71780363 CTTGTTAGAAAAACAATTACTGG + Exonic
1027485937 7:78761788-78761810 GTTGTTACAAGCAGAATTTCGGG - Intronic
1027541791 7:79476277-79476299 CTTGTTAGAAAATGCATTTCCGG - Intergenic
1028210280 7:88065818-88065840 ATTCTTAGAAACAGAATTGCAGG + Intronic
1030160792 7:106506502-106506524 ATTGTTAGAGGCAGAATTTGAGG - Intergenic
1030662345 7:112234179-112234201 TTTCTTAAAAGTAGAATTTCTGG + Intronic
1031000310 7:116407805-116407827 ATTCTTGGAAGTAGAATTTCTGG + Intronic
1031297190 7:120015363-120015385 ATTGTTTGAAGCTGAATTGCTGG - Intergenic
1031493339 7:122416840-122416862 CTTCTCTGTAGCAGAATTTCAGG - Intronic
1032260547 7:130332829-130332851 CTTGTCAGAAACAGAATCTCTGG + Intergenic
1032646819 7:133834099-133834121 CTTATTTGAAGCAGAATTGTGGG + Intronic
1032814709 7:135461396-135461418 TTTGTTAGGAGCAGCCTTTCAGG - Intronic
1034366898 7:150558177-150558199 CCCATTAGAAGCAGATTTTCAGG + Intergenic
1034895256 7:154872320-154872342 CTCGCTAGCAGCAGAATTTCAGG - Intronic
1036477307 8:9104836-9104858 GTTGTTAGAACCGGAATTTCAGG + Intronic
1037872941 8:22516435-22516457 AGTTTTAGAAGTAGAATTTCTGG - Intronic
1040768173 8:50941616-50941638 CTTGTTAAAAACAGGATTTCTGG + Intergenic
1040885385 8:52257293-52257315 CTACTTAGAAGAAGAATTGCTGG + Intronic
1041315651 8:56559473-56559495 CTTAGTGGAAGCAGGATTTCAGG + Intergenic
1041593721 8:59621476-59621498 ATACCTAGAAGCAGAATTTCTGG + Intergenic
1042011268 8:64247534-64247556 CTTGTTAGAAATAAAATTTCTGG + Intergenic
1042075376 8:64988084-64988106 CAAGTTAGAAGCAGCATATCAGG - Intergenic
1042463993 8:69105319-69105341 CTAATGAGTAGCAGAATTTCAGG - Intergenic
1043295256 8:78654088-78654110 CATGTCAGAAGGAGAGTTTCTGG + Intergenic
1045140204 8:99272001-99272023 CTTGTTAAATGCAGAATTCTGGG + Intronic
1045257252 8:100536811-100536833 ATTGTTAAAAGCAGAACTTTGGG + Intronic
1045618102 8:103940935-103940957 GTTGTTAGGAGCAGAGATTCTGG + Intronic
1046711113 8:117512662-117512684 CATGATGAAAGCAGAATTTCAGG + Intergenic
1046714706 8:117554832-117554854 CTTGTAAAACGCAGAATCTCAGG - Intergenic
1046839991 8:118845360-118845382 CTTATTACAAGCAGAAGTTCTGG + Intergenic
1049281610 8:141752268-141752290 CTTTCTAGAAGCAGTATTGCTGG - Intergenic
1050050822 9:1599685-1599707 CTTCTTGGAAGCAAAATTTCTGG - Intergenic
1050141779 9:2523598-2523620 CTGCTTAGAACCAGAATTTTTGG - Intergenic
1050181502 9:2927855-2927877 CTTGGTAGAAGCAGAAGATTAGG - Intergenic
1050182985 9:2940323-2940345 ATTGCTAAAAGCAGAATTACTGG - Intergenic
1050951138 9:11596034-11596056 TTTGGTTGAAGTAGAATTTCAGG + Intergenic
1051156445 9:14152447-14152469 CATGCTAGAAGGAGTATTTCAGG + Intronic
1051283963 9:15475492-15475514 ATTGTTAGAAGCAGATTTGCTGG - Intronic
1051365870 9:16320873-16320895 ATTGTTAGAAGCAGATATGCAGG - Intergenic
1051696874 9:19777416-19777438 TTTCGTAGAAGCAGAATTTCTGG - Intronic
1052710989 9:32055225-32055247 ATTGTAAAAAGCAGAATTTTAGG - Intergenic
1052715685 9:32114198-32114220 GTAGCCAGAAGCAGAATTTCTGG - Intergenic
1052779514 9:32766304-32766326 ATACTTAGGAGCAGAATTTCTGG + Intergenic
1053501445 9:38598550-38598572 CTTGTTACAAGTAGAGTTCCTGG - Intergenic
1053595731 9:39559279-39559301 CTTTTAAAAAGCAGCATTTCTGG + Intergenic
1053853699 9:42315906-42315928 CTTTTAAAAAGCAGCATTTCTGG + Intergenic
1054570525 9:66805725-66805747 CTTTTAAAAAGCAGCATTTCTGG - Intergenic
1054966616 9:71035295-71035317 GTTGTTATTAGGAGAATTTCTGG - Intronic
1055154709 9:73046144-73046166 ATGCTAAGAAGCAGAATTTCTGG + Intronic
1055387432 9:75777120-75777142 TTTTTTAAAAGCAGAAATTCAGG + Intergenic
1057094167 9:92290068-92290090 GTAGCTAGAAGTAGAATTTCTGG + Intronic
1057328411 9:94088714-94088736 ATTGTTAGAAGTAGAATTCCTGG - Intronic
1057672295 9:97103962-97103984 TTTGTTAGAAGAAAAACTTCAGG + Intergenic
1057680838 9:97182936-97182958 CTTGTTACAAGTAGAGTTCCTGG - Intergenic
1057887924 9:98845220-98845242 CTTGTTTTAAGCAGCTTTTCAGG + Intronic
1058079590 9:100687985-100688007 GCTGTTAAATGCAGAATTTCAGG - Intergenic
1058804040 9:108572952-108572974 AGTCTTAGAAGCAGAATTGCTGG - Intergenic
1058810892 9:108637869-108637891 ATTATTAGAAGTAAAATTTCTGG + Intergenic
1061175282 9:128991870-128991892 CTTGATAAAAGCAGAATTCCTGG + Intronic
1061336080 9:129937223-129937245 ATTTTCAGAAGCAGAATTTTTGG - Intronic
1186624882 X:11282636-11282658 TTTGATCGAAACAGAATTTCTGG + Intronic
1187000965 X:15177309-15177331 ATACTTAGAAGTAGAATTTCTGG + Intergenic
1187323476 X:18263783-18263805 TTTGATAGATACAGAATTTCAGG + Intronic
1188179042 X:27031220-27031242 CTTGTCAGAAGCACAATGCCTGG - Intergenic
1188852871 X:35152982-35153004 TTTTTTATAAGCAGAACTTCAGG + Intergenic
1192217522 X:69173081-69173103 ATTCCTAGAAGTAGAATTTCTGG - Intergenic
1193678874 X:84492355-84492377 ATTGCTACAAGCAGAAATTCAGG + Intronic
1193971403 X:88059082-88059104 CATGTTAGCAGTGGAATTTCTGG - Intergenic
1196047132 X:111268106-111268128 CTTTTTAGACCCAGAATATCTGG - Intronic
1196486148 X:116210404-116210426 ATTATAAGAAGTAGAATTTCTGG - Intergenic
1198460070 X:136854686-136854708 CTAGTTAGAAACATGATTTCTGG + Intronic
1198460503 X:136858632-136858654 CTAGTTAGAAACATGATTTCTGG + Intronic
1198492623 X:137157698-137157720 GTTTTTAGAAGCATGATTTCTGG - Intergenic
1198746838 X:139899783-139899805 GTGGTTAGAAGCAGAGTTTGGGG - Intronic
1199005238 X:142688381-142688403 CTTTATAGAAGTAAAATTTCTGG + Intergenic
1199290235 X:146096970-146096992 TTTGATTGAAGCAGAAGTTCAGG + Intergenic
1199304162 X:146247690-146247712 CTTGTCAGAAACAGATTGTCAGG - Intergenic
1199782689 X:151077148-151077170 ATTACTAGAAGCAGAATTGCTGG - Intergenic
1199964104 X:152804637-152804659 ATACTTAGAAGTAGAATTTCTGG - Intergenic
1200006666 X:153089760-153089782 CTGGACAGAAGCAGAATCTCAGG - Intergenic
1200699932 Y:6393435-6393457 CTTTTGGCAAGCAGAATTTCAGG - Intergenic
1201034179 Y:9771263-9771285 CTTTTGGCAAGCAGAATTTCAGG + Intergenic
1201355385 Y:13092109-13092131 TGTGTTAGAAGCAGATTTTTCGG - Intergenic
1202087581 Y:21154796-21154818 GTTGTTAGGAGCAGTATATCAGG + Intergenic
1202365952 Y:24164851-24164873 ATTCATAGAAGTAGAATTTCTGG + Intergenic
1202374469 Y:24221167-24221189 ATTCATAGAAGTAGAATTTCTGG - Intergenic
1202496311 Y:25448953-25448975 ATTCATAGAAGTAGAATTTCTGG + Intergenic
1202504830 Y:25505272-25505294 ATTCATAGAAGTAGAATTTCTGG - Intergenic