ID: 958040955

View in Genome Browser
Species Human (GRCh38)
Location 3:88225753-88225775
Sequence TCCCAATGTCTTTACTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958040955_958040958 3 Left 958040955 3:88225753-88225775 CCCTGAAAGTAAAGACATTGGGA No data
Right 958040958 3:88225779-88225801 AAGTTATGATATCTTCTGCAGGG No data
958040955_958040959 24 Left 958040955 3:88225753-88225775 CCCTGAAAGTAAAGACATTGGGA No data
Right 958040959 3:88225800-88225822 GGCTGAGAAATATTAATTGCAGG No data
958040955_958040957 2 Left 958040955 3:88225753-88225775 CCCTGAAAGTAAAGACATTGGGA No data
Right 958040957 3:88225778-88225800 TAAGTTATGATATCTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958040955 Original CRISPR TCCCAATGTCTTTACTTTCA GGG (reversed) Intergenic