ID: 958040955 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:88225753-88225775 |
| Sequence | TCCCAATGTCTTTACTTTCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 958040955_958040958 | 3 | Left | 958040955 | 3:88225753-88225775 | CCCTGAAAGTAAAGACATTGGGA | No data | ||
| Right | 958040958 | 3:88225779-88225801 | AAGTTATGATATCTTCTGCAGGG | No data | ||||
| 958040955_958040959 | 24 | Left | 958040955 | 3:88225753-88225775 | CCCTGAAAGTAAAGACATTGGGA | No data | ||
| Right | 958040959 | 3:88225800-88225822 | GGCTGAGAAATATTAATTGCAGG | No data | ||||
| 958040955_958040957 | 2 | Left | 958040955 | 3:88225753-88225775 | CCCTGAAAGTAAAGACATTGGGA | No data | ||
| Right | 958040957 | 3:88225778-88225800 | TAAGTTATGATATCTTCTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 958040955 | Original CRISPR | TCCCAATGTCTTTACTTTCA GGG (reversed) | Intergenic | ||