ID: 958049279

View in Genome Browser
Species Human (GRCh38)
Location 3:88323739-88323761
Sequence GTGTCGAAGGGGAACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958049269_958049279 8 Left 958049269 3:88323708-88323730 CCCAGATCTCATCTTGAATTGTA 0: 163
1: 7168
2: 10574
3: 9468
4: 7823
Right 958049279 3:88323739-88323761 GTGTCGAAGGGGAACCTGGTGGG No data
958049270_958049279 7 Left 958049270 3:88323709-88323731 CCAGATCTCATCTTGAATTGTAA 0: 63
1: 2502
2: 10126
3: 12505
4: 11656
Right 958049279 3:88323739-88323761 GTGTCGAAGGGGAACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958049279 Original CRISPR GTGTCGAAGGGGAACCTGGT GGG Intergenic
No off target data available for this crispr