ID: 958056179

View in Genome Browser
Species Human (GRCh38)
Location 3:88415385-88415407
Sequence CAGGGTTAAAACAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958056175_958056179 -1 Left 958056175 3:88415363-88415385 CCTATTCAGAAGAAGCAATCTGC No data
Right 958056179 3:88415385-88415407 CAGGGTTAAAACAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958056179 Original CRISPR CAGGGTTAAAACAATGAGGA TGG Intergenic
No off target data available for this crispr