ID: 958056212

View in Genome Browser
Species Human (GRCh38)
Location 3:88415728-88415750
Sequence CTGTGGTTCTTGAAGTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958056212_958056217 21 Left 958056212 3:88415728-88415750 CCATCTAACTTCAAGAACCACAG No data
Right 958056217 3:88415772-88415794 CAAGCCCTAAAGCCAGATTCTGG No data
958056212_958056218 24 Left 958056212 3:88415728-88415750 CCATCTAACTTCAAGAACCACAG No data
Right 958056218 3:88415775-88415797 GCCCTAAAGCCAGATTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958056212 Original CRISPR CTGTGGTTCTTGAAGTTAGA TGG (reversed) Intergenic
No off target data available for this crispr