ID: 958057674

View in Genome Browser
Species Human (GRCh38)
Location 3:88434099-88434121
Sequence TGCCCCCAAGTCTACATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958057674_958057680 19 Left 958057674 3:88434099-88434121 CCTAAAATGTAGACTTGGGGGCA No data
Right 958057680 3:88434141-88434163 AGGATCCTTTGTTTGCAATGTGG No data
958057674_958057678 -9 Left 958057674 3:88434099-88434121 CCTAAAATGTAGACTTGGGGGCA No data
Right 958057678 3:88434113-88434135 TTGGGGGCATGGAGGAGATTGGG No data
958057674_958057682 29 Left 958057674 3:88434099-88434121 CCTAAAATGTAGACTTGGGGGCA No data
Right 958057682 3:88434151-88434173 GTTTGCAATGTGGAAGTTGATGG No data
958057674_958057677 -10 Left 958057674 3:88434099-88434121 CCTAAAATGTAGACTTGGGGGCA No data
Right 958057677 3:88434112-88434134 CTTGGGGGCATGGAGGAGATTGG No data
958057674_958057679 -1 Left 958057674 3:88434099-88434121 CCTAAAATGTAGACTTGGGGGCA No data
Right 958057679 3:88434121-88434143 ATGGAGGAGATTGGGTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958057674 Original CRISPR TGCCCCCAAGTCTACATTTT AGG (reversed) Intergenic
No off target data available for this crispr