ID: 958059961

View in Genome Browser
Species Human (GRCh38)
Location 3:88467039-88467061
Sequence CTGGATATCCCGTTCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958059961_958059968 8 Left 958059961 3:88467039-88467061 CCACATCTGAACGGGATATCCAG No data
Right 958059968 3:88467070-88467092 TATGAAGCAAATATGGTGGGCGG No data
958059961_958059965 1 Left 958059961 3:88467039-88467061 CCACATCTGAACGGGATATCCAG No data
Right 958059965 3:88467063-88467085 GACTTAATATGAAGCAAATATGG No data
958059961_958059967 5 Left 958059961 3:88467039-88467061 CCACATCTGAACGGGATATCCAG No data
Right 958059967 3:88467067-88467089 TAATATGAAGCAAATATGGTGGG No data
958059961_958059966 4 Left 958059961 3:88467039-88467061 CCACATCTGAACGGGATATCCAG No data
Right 958059966 3:88467066-88467088 TTAATATGAAGCAAATATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958059961 Original CRISPR CTGGATATCCCGTTCAGATG TGG (reversed) Intergenic
No off target data available for this crispr