ID: 958065071

View in Genome Browser
Species Human (GRCh38)
Location 3:88534268-88534290
Sequence TAAGCAGCTCACATTAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958065071_958065077 24 Left 958065071 3:88534268-88534290 CCCAGATTAATGTGAGCTGCTTA No data
Right 958065077 3:88534315-88534337 TGCAAGGCCATTTTGATGCTGGG No data
958065071_958065076 23 Left 958065071 3:88534268-88534290 CCCAGATTAATGTGAGCTGCTTA No data
Right 958065076 3:88534314-88534336 CTGCAAGGCCATTTTGATGCTGG No data
958065071_958065074 8 Left 958065071 3:88534268-88534290 CCCAGATTAATGTGAGCTGCTTA No data
Right 958065074 3:88534299-88534321 TCACCATCTTTAGCACTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958065071 Original CRISPR TAAGCAGCTCACATTAATCT GGG (reversed) Intergenic
No off target data available for this crispr