ID: 958065074

View in Genome Browser
Species Human (GRCh38)
Location 3:88534299-88534321
Sequence TCACCATCTTTAGCACTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958065072_958065074 7 Left 958065072 3:88534269-88534291 CCAGATTAATGTGAGCTGCTTAA No data
Right 958065074 3:88534299-88534321 TCACCATCTTTAGCACTGCAAGG No data
958065069_958065074 20 Left 958065069 3:88534256-88534278 CCCTCTGGAAAACCCAGATTAAT No data
Right 958065074 3:88534299-88534321 TCACCATCTTTAGCACTGCAAGG No data
958065071_958065074 8 Left 958065071 3:88534268-88534290 CCCAGATTAATGTGAGCTGCTTA No data
Right 958065074 3:88534299-88534321 TCACCATCTTTAGCACTGCAAGG No data
958065068_958065074 21 Left 958065068 3:88534255-88534277 CCCCTCTGGAAAACCCAGATTAA No data
Right 958065074 3:88534299-88534321 TCACCATCTTTAGCACTGCAAGG No data
958065070_958065074 19 Left 958065070 3:88534257-88534279 CCTCTGGAAAACCCAGATTAATG No data
Right 958065074 3:88534299-88534321 TCACCATCTTTAGCACTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958065074 Original CRISPR TCACCATCTTTAGCACTGCA AGG Intergenic
No off target data available for this crispr