ID: 958065076

View in Genome Browser
Species Human (GRCh38)
Location 3:88534314-88534336
Sequence CTGCAAGGCCATTTTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958065071_958065076 23 Left 958065071 3:88534268-88534290 CCCAGATTAATGTGAGCTGCTTA No data
Right 958065076 3:88534314-88534336 CTGCAAGGCCATTTTGATGCTGG No data
958065072_958065076 22 Left 958065072 3:88534269-88534291 CCAGATTAATGTGAGCTGCTTAA No data
Right 958065076 3:88534314-88534336 CTGCAAGGCCATTTTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958065076 Original CRISPR CTGCAAGGCCATTTTGATGC TGG Intergenic
No off target data available for this crispr