ID: 958065077

View in Genome Browser
Species Human (GRCh38)
Location 3:88534315-88534337
Sequence TGCAAGGCCATTTTGATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958065075_958065077 -10 Left 958065075 3:88534302-88534324 CCATCTTTAGCACTGCAAGGCCA No data
Right 958065077 3:88534315-88534337 TGCAAGGCCATTTTGATGCTGGG No data
958065072_958065077 23 Left 958065072 3:88534269-88534291 CCAGATTAATGTGAGCTGCTTAA No data
Right 958065077 3:88534315-88534337 TGCAAGGCCATTTTGATGCTGGG No data
958065071_958065077 24 Left 958065071 3:88534268-88534290 CCCAGATTAATGTGAGCTGCTTA No data
Right 958065077 3:88534315-88534337 TGCAAGGCCATTTTGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958065077 Original CRISPR TGCAAGGCCATTTTGATGCT GGG Intergenic
No off target data available for this crispr