ID: 958068474 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:88577246-88577268 |
Sequence | AGATACATTGCTTCCCTTAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
958068474_958068477 | 17 | Left | 958068474 | 3:88577246-88577268 | CCACTAAGGGAAGCAATGTATCT | No data | ||
Right | 958068477 | 3:88577286-88577308 | TCAGACAGAACCTAAAAGGAAGG | No data | ||||
958068474_958068476 | 13 | Left | 958068474 | 3:88577246-88577268 | CCACTAAGGGAAGCAATGTATCT | No data | ||
Right | 958068476 | 3:88577282-88577304 | GAATTCAGACAGAACCTAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
958068474 | Original CRISPR | AGATACATTGCTTCCCTTAG TGG (reversed) | Intergenic | ||