ID: 958068475

View in Genome Browser
Species Human (GRCh38)
Location 3:88577269-88577291
Sequence GTCTGAATTCTGCTGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958068475_958068482 22 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068482 3:88577314-88577336 AGATCTTACTAGGGGCACTCAGG No data
958068475_958068477 -6 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068477 3:88577286-88577308 TCAGACAGAACCTAAAAGGAAGG No data
958068475_958068476 -10 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068476 3:88577282-88577304 GAATTCAGACAGAACCTAAAAGG No data
958068475_958068481 14 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068481 3:88577306-88577328 AGGCATATAGATCTTACTAGGGG No data
958068475_958068480 13 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068480 3:88577305-88577327 AAGGCATATAGATCTTACTAGGG No data
958068475_958068479 12 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068479 3:88577304-88577326 GAAGGCATATAGATCTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958068475 Original CRISPR GTCTGAATTCTGCTGTTTTC TGG (reversed) Intergenic
No off target data available for this crispr