ID: 958068476

View in Genome Browser
Species Human (GRCh38)
Location 3:88577282-88577304
Sequence GAATTCAGACAGAACCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958068475_958068476 -10 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068476 3:88577282-88577304 GAATTCAGACAGAACCTAAAAGG No data
958068474_958068476 13 Left 958068474 3:88577246-88577268 CCACTAAGGGAAGCAATGTATCT No data
Right 958068476 3:88577282-88577304 GAATTCAGACAGAACCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958068476 Original CRISPR GAATTCAGACAGAACCTAAA AGG Intergenic
No off target data available for this crispr