ID: 958068477

View in Genome Browser
Species Human (GRCh38)
Location 3:88577286-88577308
Sequence TCAGACAGAACCTAAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958068475_958068477 -6 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068477 3:88577286-88577308 TCAGACAGAACCTAAAAGGAAGG No data
958068474_958068477 17 Left 958068474 3:88577246-88577268 CCACTAAGGGAAGCAATGTATCT No data
Right 958068477 3:88577286-88577308 TCAGACAGAACCTAAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958068477 Original CRISPR TCAGACAGAACCTAAAAGGA AGG Intergenic