ID: 958068480

View in Genome Browser
Species Human (GRCh38)
Location 3:88577305-88577327
Sequence AAGGCATATAGATCTTACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958068475_958068480 13 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068480 3:88577305-88577327 AAGGCATATAGATCTTACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958068480 Original CRISPR AAGGCATATAGATCTTACTA GGG Intergenic
No off target data available for this crispr