ID: 958068481

View in Genome Browser
Species Human (GRCh38)
Location 3:88577306-88577328
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958068475_958068481 14 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068481 3:88577306-88577328 AGGCATATAGATCTTACTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr