ID: 958068481 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:88577306-88577328 |
Sequence | AGGCATATAGATCTTACTAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
958068475_958068481 | 14 | Left | 958068475 | 3:88577269-88577291 | CCAGAAAACAGCAGAATTCAGAC | No data | ||
Right | 958068481 | 3:88577306-88577328 | AGGCATATAGATCTTACTAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
958068481 | Original CRISPR | AGGCATATAGATCTTACTAG GGG | Intergenic | ||