ID: 958068482

View in Genome Browser
Species Human (GRCh38)
Location 3:88577314-88577336
Sequence AGATCTTACTAGGGGCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958068478_958068482 -5 Left 958068478 3:88577296-88577318 CCTAAAAGGAAGGCATATAGATC No data
Right 958068482 3:88577314-88577336 AGATCTTACTAGGGGCACTCAGG No data
958068475_958068482 22 Left 958068475 3:88577269-88577291 CCAGAAAACAGCAGAATTCAGAC No data
Right 958068482 3:88577314-88577336 AGATCTTACTAGGGGCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958068482 Original CRISPR AGATCTTACTAGGGGCACTC AGG Intergenic
No off target data available for this crispr