ID: 958068707

View in Genome Browser
Species Human (GRCh38)
Location 3:88580264-88580286
Sequence GACGTAACACCCTTAGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958068707_958068709 -7 Left 958068707 3:88580264-88580286 CCCTATGCTAAGGGTGTTACGTC No data
Right 958068709 3:88580280-88580302 TTACGTCAAGTAATCCTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958068707 Original CRISPR GACGTAACACCCTTAGCATA GGG (reversed) Intergenic
No off target data available for this crispr