ID: 958069030

View in Genome Browser
Species Human (GRCh38)
Location 3:88585355-88585377
Sequence CATGGTGAGCAGAGAGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958069030_958069034 5 Left 958069030 3:88585355-88585377 CCAAGTACTCTCTGCTCACCATG No data
Right 958069034 3:88585383-88585405 TCATGAAAAAGAAGGAGTAAAGG No data
958069030_958069033 -3 Left 958069030 3:88585355-88585377 CCAAGTACTCTCTGCTCACCATG No data
Right 958069033 3:88585375-88585397 ATGGATAATCATGAAAAAGAAGG No data
958069030_958069035 22 Left 958069030 3:88585355-88585377 CCAAGTACTCTCTGCTCACCATG No data
Right 958069035 3:88585400-88585422 TAAAGGAATCTCTTTCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958069030 Original CRISPR CATGGTGAGCAGAGAGTACT TGG (reversed) Intergenic
No off target data available for this crispr