ID: 958069104

View in Genome Browser
Species Human (GRCh38)
Location 3:88586235-88586257
Sequence TCTCTTGGTGTTTCTCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958069104_958069109 12 Left 958069104 3:88586235-88586257 CCACAGTGAGAAACACCAAGAGA No data
Right 958069109 3:88586270-88586292 TCTTTAATCTGTTTTGCTGAGGG No data
958069104_958069108 11 Left 958069104 3:88586235-88586257 CCACAGTGAGAAACACCAAGAGA No data
Right 958069108 3:88586269-88586291 ATCTTTAATCTGTTTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958069104 Original CRISPR TCTCTTGGTGTTTCTCACTG TGG (reversed) Intergenic
No off target data available for this crispr