ID: 958075155

View in Genome Browser
Species Human (GRCh38)
Location 3:88666829-88666851
Sequence GTATCTTCTTGGTTACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958075155_958075162 30 Left 958075155 3:88666829-88666851 CCAGTGTGTAACCAAGAAGATAC No data
Right 958075162 3:88666882-88666904 ATCCAGGCAGTTCTCCATTTGGG No data
958075155_958075157 0 Left 958075155 3:88666829-88666851 CCAGTGTGTAACCAAGAAGATAC No data
Right 958075157 3:88666852-88666874 TTAGCCATTTGCTGAATGAATGG No data
958075155_958075159 4 Left 958075155 3:88666829-88666851 CCAGTGTGTAACCAAGAAGATAC No data
Right 958075159 3:88666856-88666878 CCATTTGCTGAATGAATGGATGG No data
958075155_958075160 14 Left 958075155 3:88666829-88666851 CCAGTGTGTAACCAAGAAGATAC No data
Right 958075160 3:88666866-88666888 AATGAATGGATGGATGATCCAGG No data
958075155_958075161 29 Left 958075155 3:88666829-88666851 CCAGTGTGTAACCAAGAAGATAC No data
Right 958075161 3:88666881-88666903 GATCCAGGCAGTTCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958075155 Original CRISPR GTATCTTCTTGGTTACACAC TGG (reversed) Intergenic