ID: 958075156

View in Genome Browser
Species Human (GRCh38)
Location 3:88666840-88666862
Sequence CAAATGGCTAAGTATCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958075156_958075160 3 Left 958075156 3:88666840-88666862 CCAAGAAGATACTTAGCCATTTG No data
Right 958075160 3:88666866-88666888 AATGAATGGATGGATGATCCAGG No data
958075156_958075162 19 Left 958075156 3:88666840-88666862 CCAAGAAGATACTTAGCCATTTG No data
Right 958075162 3:88666882-88666904 ATCCAGGCAGTTCTCCATTTGGG No data
958075156_958075159 -7 Left 958075156 3:88666840-88666862 CCAAGAAGATACTTAGCCATTTG No data
Right 958075159 3:88666856-88666878 CCATTTGCTGAATGAATGGATGG No data
958075156_958075161 18 Left 958075156 3:88666840-88666862 CCAAGAAGATACTTAGCCATTTG No data
Right 958075161 3:88666881-88666903 GATCCAGGCAGTTCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958075156 Original CRISPR CAAATGGCTAAGTATCTTCT TGG (reversed) Intergenic
No off target data available for this crispr