ID: 958075158

View in Genome Browser
Species Human (GRCh38)
Location 3:88666856-88666878
Sequence CCATCCATTCATTCAGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958075158_958075165 22 Left 958075158 3:88666856-88666878 CCATTTGCTGAATGAATGGATGG No data
Right 958075165 3:88666901-88666923 TGGGTAGCCTATCAGTGAACTGG No data
958075158_958075161 2 Left 958075158 3:88666856-88666878 CCATTTGCTGAATGAATGGATGG No data
Right 958075161 3:88666881-88666903 GATCCAGGCAGTTCTCCATTTGG No data
958075158_958075162 3 Left 958075158 3:88666856-88666878 CCATTTGCTGAATGAATGGATGG No data
Right 958075162 3:88666882-88666904 ATCCAGGCAGTTCTCCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958075158 Original CRISPR CCATCCATTCATTCAGCAAA TGG (reversed) Intergenic
No off target data available for this crispr