ID: 958075161

View in Genome Browser
Species Human (GRCh38)
Location 3:88666881-88666903
Sequence GATCCAGGCAGTTCTCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958075156_958075161 18 Left 958075156 3:88666840-88666862 CCAAGAAGATACTTAGCCATTTG No data
Right 958075161 3:88666881-88666903 GATCCAGGCAGTTCTCCATTTGG No data
958075158_958075161 2 Left 958075158 3:88666856-88666878 CCATTTGCTGAATGAATGGATGG No data
Right 958075161 3:88666881-88666903 GATCCAGGCAGTTCTCCATTTGG No data
958075155_958075161 29 Left 958075155 3:88666829-88666851 CCAGTGTGTAACCAAGAAGATAC No data
Right 958075161 3:88666881-88666903 GATCCAGGCAGTTCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958075161 Original CRISPR GATCCAGGCAGTTCTCCATT TGG Intergenic
No off target data available for this crispr